Description :
From Genome Similarity Track
Location :
contig_75:130225- 137139
Transcript NameFunction/comments
g11790.t1hypothetical protein

Sequence
6914 bases(100 bases per row)
TAGTCTGGAAACTGCGAGTCGGATGAAGATGCAGCACCTTCGTCGCGGTGAAGAGCACGTGGTCTGGCTAACGTCTATGGAGACTCCACGATCGTGCATT
CTTCTGTACGGCAATGCCGAGGCCAGGCCTTTCAACCTCGCCACTGCACCCGTGCTGAATTTCACAGAAGGCTCTGTTGTTGGAAATCTTGGGGCTCCAC
CTCGTGCATCAATTCAGCGTCCTGCTACCTCTGAAAAGAGTGAAGCTTCGTCTTCTAATACACTAGCAAATTCAACGGTTGGTGCAGCCGACAGTAAATG
GCGTCGGGTCAAGCGAGAAAACTCGCTGCGGAAGGATATCCACTTGTACAACAAGATCATCCTCTCGGGGCCGGCCGACTACATCGTGCTCACCGCGAGT
GACGTTCGGGACAATGCCTCCGGTGCATCTGATCGTCTCCACTGGGCCAAGATTTTTGGGCTGGAGAGGTTTGCAGGATGTCTGCGGCAGACTGTCTTCG
AGCCTGGTGCGATTATTGTCCAAGAGGGCCACCAGCTTAACTCTCTCCATCTCGTTGTTGAAGGCGAGTGTCGGGCCTCTGTTGGGCGTGACGACTTCAA
TAGCCCAAGCACCGTTCAGCCAACCGACACCAGCTCAAACAGCACCAAACCACCACTGACGACTGCAGAGGCTCAGCTCCGGCACACTCGAAAATTTCGC
TGGAGTGACGATTCTCAGTTGCCTGTGGCCTCGCTCGGACCAAAGTCCACGATTGGGGATATTTCACTCATGCTAGGAATCCCAGAGCCCACCACCGTTA
GGGCTGTCACGACAGTAAACGTCCTCTCGCTTTCCCAGGAAGACTTCGTGCGCGAGAGCAGTGACCGACATGATCCAGCTATAGCCACTTGCATCGAAAG
TAAGCATCGCAAGCCAGCTTTGATACCTGTTGTCTCCGCACGCTAATTGCTGCACTTGTCTAACGATGCTCAGAATTGCAGAGCACAGCGTACGATACAC
TGCGATTCGTGCTGGAACGTGTCGAAATTGAGTCCAAGAACGAGCACTGCGACCAGCGTCTCAAGATCGATTCCTTACGCGAAGCACTGCGCCAGAAACA
TCCAGGTATCTCCCCCCCTGGATCATACGCATGTTACTGCTTTGTACTGCGACGTTCACTGACACACCGATGTGATGCAACGCAGTGATGACGAAAGACA
AGCAGTCGACAAGCACTTCTTCGGGTTCTACTGCAAATACGCACAGAGCCTCCAGTACATCTTCTCAGCCTGAACAACCAGAAGCCATCAGTGCTGGAGG
ACAGTGCTCTAGCGTCGTATCTCTGCCATCGGTAGTGCTGAAGCATGCCACAGCCAGTGCAGTCACGAGAAGGCAACACATCCGTAACCAGCTCGGGACT
TCCGTCGCTGCCGTTGCGGGAGAAGACGTAGGTCCACTTGAAAGCTCCACAGGAATGACTCGGCAGCAACGCAAAGCAGCGCGAGCCTTTGCGAGCCTGC
AGTTCCCTGTGGCTGGTAAATGTCTCGGGGACTGCGTGAAGACGCCCAGCAGAGCCTCAGTTGACGAGTCTCCCGTCACAAGTCCAGACTTGCAAGCCAC
TCCGCAAACCGAGGACCTGCTGTTTTTGTTCCCCACGATGACTCAGCGCCGACAACTTCACGGAAAGTACGTAAACCTTGTCTTTGTCTGCTTCATCGTC
ACTGATCCAGCTCCATGGTAATGACAGGAATTTACCACTGCTGCCTCGATATCGAGGCTTCGATGCTGTCCCAACAGAGTAAGCGCTTCAGCTGCTCCAT
CATCAGATAGTCTCGTACAACCCTGTACCGCACAAGCACGATCGGATCAAACCAACACAAATACAATTCGCTCTCCGTTACTGGGCAAGCATACATGAAT
TACCGAACACAAGTACCAATCTTCGCAGCGGCGTCTCACTCTGCCTTCACCTCCTCAGTCTCACGATCAATTAGATCTCAGTAGGCCTTCCTTTTGTCAT
CATTTTTGGTCGGCGGTCGCGAAGTCTGGCCCTCGAATCTTGGCGTCATCAGCAAGGGCAACTGAGGAAGTGGCTGCAGCATTGTCACTCGGTCGCTCCG
TTTTCACCTTCTCAAACGATGAGGTTTGCTGTTCCATGGGCTTCTCACTAGTCTCTCTCTCGGACTCCTTCCGCTGCTCCTGCGATGTATCTAGTTTCAC
CCCTTGCGTGACTGCTTGAGCGTTAGGCTTTGCAATTTCTCCCGTCATGGGGTTATCTTCCTGTGAAGCTGATGCAAGCGTCTTCAGAGCCGTTAGCGTG
GCCTCATCGGTAGATGTCTTGCCCCCCGCTGCATTTACTGTGTCTGTCGTTGTCTTAGCTTTCTTTGCAGCAACTGATTCATCGGCAGCCGCAGAGGATG
AAGACGGCGATGTTTCTGATACCGCGCTGTCATCCTCAGATAAGCCACGAGCACGCTTCTTCAGCAACGTGGCAGACTCCAAAGCCTTCGTCGCATTGCC
CATACGAGCATCATCGGACGAAGCACTGGCACTGTCACTCTGCTCAACGCTTCCAGAGGAGGCTGGCGTCGCAACCTCCTTTTTCACATCATCGTCTTCC
TTTGACTCTCCCATCAGCTCGTCGTCATCGTCATCCATCGAATCGTGCACGGGCGTTTCATGCACGGGCGATCCATACACGGGTGTTGCCGACGGCGTGT
CTACAGGTGTAGCACTCGGGGACTCATCGTCATCATCGTCGTCGTCTCCATCTTCATCCATGGAACCCAGGTACTCAATAGCCAACTCCGGTTCAAAAGC
CACTTGCTGGACTCCGGGGCCCTTACGCGTGGCGAGGGCGCCCAAATCTTAAATGGCTCAGAGAAACCGGACGGAGTGGAGCCACCACGGGCTTCCAGGG
GTGTCTTGCGCAGCACACCAGGATTGAACTCGATGCGGAAAGCACCTTCACCTTCGAAGATGGACTTCGTCTTATTGAGGTAGGCGGCGGCCTTGGCTTC
GGCGCCTGCCGGATCTGCTGAGGGCTTTGGCTCGCCCTGCTGCTCCCCAAACGCCTTGGTGAGCTCTTGGCATATGTCGTCATTTGCCAAGTGCTGCATC
TGTTTCAGCACCTGAGTCACCAGCTTGTCCATCGTGAACAAGAAGTACGACGTAGATCCCATGAGACTGCGGCAGGAGTCCTCGTACTTGGAATTATCAA
CCGAGCCATCGATCAGTGAGTACAGCTTCGAGAGGAAAGCCTGGTAGTCGCCGGTCTTCTCCTTGGTTGAAGCAGATAGGGAGTGGTGTGCGTGGGCAAG
AGCGCGCGCTGCCGGGTTGATTGTACGACGGTTGCGGTTGCGTTTCGCCTTCTCGCACAGGTCAAAGGCACGCTCAAGACGGTTGTGAAGCATTTGGTAC
AGACGCAGGAACGCATACGCGTGCTGGTTACCATAGAAGCGAGACTTGTAGTCAGCTTGCACCTTAGCAGCATCTTGCTTGCTGTCGAGCGCAGGGAGCC
CTGGAGGGAAAGCAGCAGCCTCCTGGATGGTAATGGCACCAGGCTGCAAGTATGCCTGGCACCCAATGGTAGCCAGGTTAATCGAGAAGTAGCCCTTCGC
CTTGTTAAACTGCTCCACGGTACCCTCGCCAAAGTCTGTGCTCGCCTCCGTACCCATCGGCAAAGTCTTGGCTTTCTCGAGCGTCACAGTAGTGCGCTGA
GGCTTGCGCACGAGCCACTCCTCCTCCAAGTGGAAGAACGGGAAGAAGAAAGCCTGCCAAACCTTGGAAACTTTTTCTTTGTCGGCCACGCTCAAGTTCT
TCTCGGCCGCATACGAAAGTAACCCGAACGCCTCCTTGTGGATCTGTACTGAAGCAAACTTGTACGCAAAGTGCGGCTTCCATTTAGCTGAAGACGAAGC
CTGCGCCGAAATTGCCGCCGCCTTTCCATCTGCCGCAATTGGAGCCTTTGCTGAATGTGCAAACTGCTCCTTCTTGAGCGCATCAGCAATATCCGATGCC
TGAGGAGGAGCCTTAACGCTGGCAACAGCAACAGTAGCTGAGACAGTGGATGGTGCTGCGCTCGAGTCCGTCTTGGACTCTTCCGCGCGCTTCTCGTCTG
CTTCCAGCTTCTTCTTCGCCTCCTGCATCATCATCTTCATACCCGTTTGCTTCTTGTCTTTCTGCTTGAAGTAGAAGCTCGAGTGGTCCAGCGACTTGTG
ATAGTTCTTTTCATTGACCTCCTTCCACTGTCGGTTAAGGTCTTCGCGCGCGCGGCGCCATTCTTCGTCCTTCTGCTTGAGGCGCTTGAGGATCACGGGA
ATCGCACCCGCCGGGTACTTACGCAGCAAGTCCAAGATCTGCGCACCAGAATCGCCGTAGATGCGCGTGATAGCATTTAGGTGCGTGACACGGAACGTAC
CCTTGTCCACAACATAGTTCCACAGCTTGTCATCATCGCCACTCGACTTCTTGCTGTTAAGTACCTCAATCTCGTGCGCAAGCGGTTCGAGAATGCTAAT
GGTGGATGCATTAGCCTCGATCACCATATCGATCTCAAAGCGCTCGTCTTCGCACTTGAACAGCGCCTCCTCGTACTGGTTCTTGCGCATGCTCTTGAAC
GAGTAATCTTCACTGCCCGTAGGCACTGATACCCAAGAGTCATTGCACACTCGCTTTTCGAGCGCTGAGCGGTGAGAGCAAGGCGGAATTGGATAGCTTG
CGGGCAGACCACGGTACGATGGGGTAGCGCGGCGGCACTGCGACAGGTCCGTTTCCGCCAGAGGAATGAATGGCCAGATTTCCTTGGGCGTCTTTTGCAC
ACCATGCGAGCACAGCAGGTGGTCGAATTCTTCCACCAAGTCCGTGTGACGGCCAAAAAGGTTCCTGATGAGCGATAGCATCTCGTTGCGATCCAGCACT
TCCTGGCTGTACAGCTCAAGACACTTCAGGAACTCGCGCCAGTTGTCGCGGGACGGAAGAATCTTCTTGATCTTCTCAAAAATATTCCACTCCTCCTTGT
CGAGCAGCACGTCCGAAATTGCCAGGTACGCACGGCGTTCCTTACCGTCGTACGGACGGCGCTTGGCGCGCTTGTGGTTGAACTGCGCACGGTTGCGCTC
GCGTTCGCGCTCCTTCTCGCGGCGCTCCAGAGCCTTTCCACTCAGGCGTTGGTCATCATCCTTGTAGCCTCTTCCCTTCTTGCCGTATTTCATATAAGCA
TCCTCGTCATCTCCCATTAAACGTCCACCCTTCATCGCAGCACTGGACGGCGAGTCACCTCCACGGTCATCTCGTCGGTCAGACTGCTGGTAGCCACCTT
GGCCAAACTTGCGAGCCTTCAGTGCCATTTGATCCTTGCGCTGCTGAGCCTTCTCGGCAGCACGGTTCAGACGCTCCTTCGCTTGCTCCTGGACCGCATC
GGGCAAGAAGAAGGTAAACTCACGCAGCAGATCCGGGTGGTCTCGGAAAAGGTGCGAGACTTGGTCCAGCACCTGGCGGATGGAGCGCTGCTCCTTCTGG
TAGGTATGCAGGATGGCCAGGAACTCCTTGTACGTCTCAGGCTCATCAGCAAAGCGTTGCTTGATAGTGGTCACGTAGTGGATCGCGTGGTCGAACTCCA
CGGGGTTCGTCGAGCTCCGTGACCCCCCGTTGCCACCACTTGGCGTCGGTGCCTGTTGCTGCTGCTTCTTCGGCTTCCCACCAGTCTTCATCTGGGCAGA
AGGGGGCAGCTGCTGACGCGACGACGGCGTCGGCTTGTGAAGCTCCGGGTGAATACGGCGGCGGAGGGATCGTCACCGGCGGTGGGCGGTGGCCCATGTT
GGCGTTCGACGACTGCCCCACTCCCGAGTACATAGACTGCTGCACACCTCCACGCCCCGCATCTGCGACGGGATCACCTCAATAGACGTGTCGGGGCGAA
TACGATACCCTGGCGGCAAGAACGTGTTAAAGCCCAGGATCAGGTTGGGATAACCGCGGAAGAGCGTCGACACACGCAGGATGACGCCGGGCGTGTCGAT
GGCCTGCGCCTTAAAGTCCTTCATGACGTCCAAGAACTGGTTGTAGATGTCAGGCTGGTCTCCGAACTGCTGCTTCACTTGGTCCAGATACAGCAGCGCG
TCCTCCACACGCAGCTCCCGATGGCGCGGGGGCGGACCCGACATGGTCTGCTGCTGCTGGTAGTAGTCTCCCTCAAGTTGGTCGTTGGGGATGATGCGTC
CGTCCAGTCCGTACTGCTGCTGAATCGGCACTTGTTGCTGCTGCTGCTGCTGCTGTGGATCCGGTTGACGACGAGGGGGCGACTGCGGGCGCACACTGTA
GCCCTGTGTGGCGGATTGAGCCCCCCGGAGGACGGAGCCATGGACTGCTGCACGCTGCCCATGCTCTGACTCAAACTGGGCGCCTGCATGCGAACCGAGT
GGCCCATCATTCCGGTGGCACTGGAAGGTGGAGCCCCCTGTGAGCCCACGGGTTTCCCCAGCACGGAGGGGGGGCCGCCCGCACCGGAGGATCCTCCCAA
GGTCCCGCGGGGCGGGTGGAGGATGGAGCCCGAGAGCGGATGCGGCGAGCGCGACGAGTTGGGCCCGCCACCGCCCAGTGACCCCTGAAGGGGCGGGGGA
GGCAACACAGGCCCTCCCGGGTGCATCATGGAGTGCTGCGGCTGTTGCTGAGGCTGCTGGGAGCCGCCGTGCAGTGGGTGCAGATGGCCGCCGTGCGTGA
GCTGCGCCAGCGACGGCTGTGGGTGGTAGCTGTGCTGCTGCTGCTGCTGGCCCGAGGGAGGGCCACCCTTGCCCCCCAAGCCCGAGCTGGAGGCCGAGCT
GAGCGACGGAGGCCCGTGGCGGTCCCCCGAAGAGCCCGGATACGATGGATTCATCGCGAGACGCGGCGAGGGCTTCGCTGGGTTTGGCGCTTGTCGGCTT
CGCCGGTTCTTTGG