Description :
From Genome Similarity Track
Location :
Scaffold_11:1302180- 1304655
Sequence
2475 bases(100 bases per row)
AGCTGGGTGGTGCTCAACAACAAGCAGGCAGAAGTGCTGGTACGACGTGGCTACAGCGTTGCAGGCGTGTCGCCGACGCTGTTGGATATATGCTCATTAA
TTTTCCGCCGGAGTCTGCAGTGGGCTAGCCGCAGACGTAATCGGTGGCGTAGTTTTCGGATGTGTTCCGGGAGTCTCTATTGCTGGTATTCCGCGATAAA
CGAGATGCTGCACTGAATATACGGAAGGTGCGTCTGCTGACGATTTCATGACGGCGTCCCGACGGGTAGCGTAGAGCCACACACAATAAAATTCGTCACT
TTCCTCTGCCTTAGGCTCCTACGAAAAACACTTCCTAGCAGAAAACTTCTTGCTAGGACTCCTGCTGCAGGAAAACTCATCCTGGAGACGAACAACACGT
ACGGTACGACAATATGACCTCAAATATTTAATGCAGAACGTCTTAAATCGTTTCATAGAATCGTAAAGGTTTTAAATGTCATTGGGTAGACTCTATACCT
ACAAGAACGTATTTCTTGTGAATCCCAGCACAAGGGACTATATCATTTTTTGTGTTTCTTCTAGAATCTTATACATTTTTTGATTGGATCCGATCGATCG
ATCAATCGGATTCAATCGAATAAGATCGAAACGAATTCAACCTCGATCGGATTAGTCAGACGAGACATATCGATTGATCCGATTCAATCCATTTCCCAAG
CCTAACTTTGGATGTAGATGCTAACCCTCCGACTTTAATCAGCTTAGATTTATCCGTGACTCGAGCTACGTTGCCAGATTGAGAGACGTTTTCCGTTTTG
CGAATTGATGTAGAGTTATAGTCGTAGGATAATTGCAGAGAATGCATAGAAATAAAAAGGTTATATTCAATGAGGGCAGAACTACCACTGTATTCATTTA
AAACTTGTCCTGTTACCCAAGTAGATCGTGATATAGTTGAACGTTGTAGCAAACATAAATAAATTACTAGGTTTGGCGTATGTGGCTGGGCTGTCCTTGC
GAGGCATCGGATAAGGGCGCTGCATCTGCCAACTTCCCCTACCATTTGTAGTACTGCTGAAACTGTTTTTGTAGTTTAACCTTTTTATTCGGTCCGTAAA
GTTGTGCGAGGCTCTCTGGTGTGACGTTTTTTCGGTACATATCTTCCAGCTTCATCAGGAACCTGTTGTGCGGTTTCATCTTGTTGACGCTGTCTTTTGG
CCTGCTAAAAAATCTGCGATGGTTGATATCATGGTTCTTTAGTCGTGACCATTTCCGCCCGCAGCCAGAGCACCAGCATCGATTTTCCTCCACATCACAT
CTCGTAGCTGTCGATGTTCCTTGGGTTCTTGGGTTTCAAACTGACGAGTTACCAGGTCTTGTACACCCTAGACACGCGAAGAGCCAGCCGCTACGCCGAA
ACTAGAGGCACCTGTCCAAACTACAAGAAGGAAGCACTTCGTCAATTACACTGCTTAATCTGTAAAAAAAAGACAAGTGCTGAATTTGGCAAGTAGACAA
TTGATACGTACCTCCTCCGTACTCAAAAATTAGGGACATTTGGACAGTGGGAACGATTGGTCACCAATTCACGAAAGCAGCACTACAATTTTTAACATTG
TTTATTTACTTATTTGTCGCCGCGTAAACTGCGTTACACGTAACGTACCACCCAAGACTTAAACACTACCTAAATGGTGCTTTTCAGTCCCGCCTACTTA
AGTAAGAGTGTACTATTAAGAGTATAATACCAAAACTTGGTATGTACGGTTTACCATACGCTTATTAAATTTAATACCGTACGGTTTATCATGCTTACCG
TACGGTTTATCATACGCTTACCGTACGGCTTACTACTCGTGACTAAACAGACTGAGAAGCTACAAGAGAGTGTTCAGTAGACAACCTCCTACGTCGGCCA
AGATACTCACGACCCCGATTAGAGGAAGACCGCGACACATTTCAAGTCTTGCCACCGATCTGGTCAAGGAAATCATGGGGGAACTCGATACACGCGACGA
ATCGAATGGTACGAGTTCCGACAACATCTCGAGTACCTTGACCGCCGCGTGATGGAGATCAACACTTATATCGAAACACACGTTCTAGGATAATTATCTA
CGCTCTAGAAATAGAACAGACAACAGACTAAAAGCTAAAATTGAAGTAAATGCACATGCCGGTTATAATACCTATCAGTGATAGCTATTTTGCATGTGTC
ACGATTAAATTGGCGGCCAGTCAGATTCCACATTGGGGGTAATTTGGTGGACGATCCAAGCATCGTACACTCCGTGTACGGCCAACGACAAACAAGAAAG
CGTCAAGAAACGAACACAGCAAACAGCTTCCAACAGACAAGGACGAACCTTTGTTGCAAGCGTCGTGACTGCATCCAGCACTCAAAACCGAGGCGCCTGT
AACCCTAGACAAGAGTGAGGGGAGCCCTATTTATTGTAGGCGCTCTCTTTGATTAATTGGGCTTCAATAAGGGGA