Description :
From Genome Similarity Track
Location :
contig_4:130196- 132574
Transcript NameFunction/comments
g1206.t1hypothetical protein
g1207.t1OWZ19648.1 hypothetical protein PHMEG_0006078 [Phytophthora megakarya

Sequence
2378 bases(100 bases per row)
GGTCGGATTGCTGCATAGAGGAGTAGCTCGGATAGCCATTGCCCGGTGCGTTGCCATTGTTATTGCTGAAGCTGGTCGTCGAAGGAGTATAGCGACCGCT
ATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGTGCCGAGTCCACCACAACCTGAGATACGACGCGAGTTAGTC
AAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCAGGTGGTGCGTGAAGGCGTGTGGAGCTACGTTTGACGTGCA
ATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTCTTCTTCTTACTGGACTGGATGGTTGGATGAGCGCGCGGGG
AGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGCGCTGGGGAAGCAAGCGCCCAAGAATAGGCAGTCAAGGCGA
GTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCCTGCTCGCCATAGCTATGGCGAGTCTGTTTGACATCGCTGC
AGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGTGCATCCTCAGTCCGCGCTTGGCATTTTGGACGAGACATTT
GAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGATCGACAAGTATGATTCAGCTCCAGCCAACTCGACTTGCCG
AGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTTCAGTGACAGCTGCGAGACGAGTGACCGCTGCAATGGCCGT
TGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAAGAGCAGTGTCGGCAAAGACCCCGATGTCACTGCAAAGGCT
GTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCTGAAGAAGGTGAATCTCTACTTCGTATGCTCTCAGACAAGT
ACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGGCTACTGACATTGATGTAACGTGTTCTATGTTGTCCACAGA
GTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTCAGCAACTCGAGGATCATCTTAGCGCTCGAAAAACTATTGA
CAAACACGTGGAAAGCAGCAGCGGCAATAACAACGACCCATCAGCCACCGGTTCCGATAGCTGGAAGACACTGCAAAAGTTGGCGCCAGCTCAACACGAA
ATGCTACAGAATCTGCTCCGTTTGCCTGAGAAACAGCTACTGAAGCTACCAAAGGCCCAGCTTGAGCTCGTGCAGTTCGCCAAGCGATATGACAAGCTCA
TCAAGGCTACACCCGACCAGCTTCGCCATCTGCCGATTGAGCACCAGCAGCTTGTTCGAAGCATGCAGCAGCAGCAGCAAAAACATGTTCCTCGCACTGA
CGAATGCAGTTAATATGGAAATTAACGCTTAGCTAAAACTTCGTCAGACCCTACAAGCATGTAAAAAGTAAAAAGTAATATCTGTGAAGCCACATTTCGT
TCATTTCTGTCAGTTGTCTTGGCCAGCCGGGTGCGAATGAAAGCTGCTGGTAGCAACAAGCACGAGCTTGTGCTTCGCGACAAATCCAGCAACATCAAAA
TTCGAGCGCTTTTCAGTTAGGTCGTCATCCGGCGCATCGGGAGCACTTCCTTCCTGGCGGAAAAGCAGCGAGACGTAGCGGTGTTCCCCCACGGGTGGTG
TCACCGGGTAGTACGGCACTACTACTACGTTTTGCGGCTGGTCTTGAACACTCTGCCCGTCCACAGCTAGGCCCGCCAAGATATAGTGCAGGAACGGCGC
GTGCGTCGGAGACTTGGGATCCGGAGCATCAATGTCGATCAGCACGTACGTGTAGCGCCCAGCACTGCCAGCTGGGTTGCCTTCAATAGAGACACTCGGT
GCTTCTTGAGCCTAGCAGTCAAGACGAGCATGATGTGAGACTTGCACTTCGTCCAACGGATTAAAAGGTAAAAGATCTGGTGGTGCCAACCTCCTTCATG
GGCACAAATTGCCCCAGGGTCACGGGGTGGCCGCCATTGAACGCGATAGCGATGTGGGCACTGCTCCCGTCCTGGATTTGGAGCTGCAGCTGCTGCAGAA
CTTGCACGGGGACAGAGACGGTGTCCATTTCGGCTGCGAGGCGAAGCGTCGTCACAGATCCGTCCTCATTTCGGAGCT