Description :
From Genome Similarity Track
Location :
contig_4:130195- 132502
Transcript NameFunction/comments
g1303.t1OWZ19648.1 hypothetical protein PHMEG_0006078 [Phytophthora megakarya

Sequence
2307 bases(100 bases per row)
GGACTGGGTCGGATTGCTGCATAGAGGAGTAACTCGGATAGCCATTGCCCGGTGCGTTGCCATTGTTATTGCTGAAGCTGGTCGTCGAAGGAGTATAGCG
ACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGTGCCGAGTCCACCACAACCTGAGATACGACGCGAG
TTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCAGGTGGTGCGTGAAGGCGTGTGGAGCTACGTTTGA
CGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTCTTCTTCTTACTGGACTGGATGGTTGGATGAGCGC
GCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGCGCTGGGGAAGCAAGCGCCCAAGAATAGGCAGTCA
AGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCCTGCTCGCCATAGCTATGGCGAGTCTGTTTGACAT
CGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGTGCATCCTCAGTCCGCGCTTGGCATTTTGGACGAG
ACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGATCGACAAGTATGATTCAGCTCCAGCCAACTCGAC
TTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTTCAGTGACAGCTGCGAGACGAGTGACCGCTGCAAT
GGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAAGAGCAGTGTCGGCAAAGACCCCGATGTCACTGCA
AAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCTGAAGAAGGTGAATCTCTACTTCGTATGCTCTCAG
ACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGGCTACTGACATTGATGTAACGTGTTCTATGTTGTC
CACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTCAGCAACTCGAGGATCATCTTAGCGCTCGAAAAAC
TATTGACAAACACGTGGAAAGCAGCAGCGGCAATAACAACGACCCATCAGCCACCGGTTCCGATAGCTGGAAGACACTGCAAAAGTTGGCGCCAGCTCAA
CACGAAATGCTACAGAATCTGCTCCGTTTGCCTGAGAAACAGCTACTGAAGCTACCAAAGGCCCAGCTTGAGCTCGTGCAGTTCGCCAAGCGATATGACA
AGCTCATCAAGGCTACACCCGACCAGCTTCGCCATCTGCCGATTGAGCACCAGCAGCTTGTTCGAAGCATGCAGCAGCAGCAGCAAAAACATGTTCCTCG
CACTGACGAATGCAGTTAATATGGAAATTAACGCTTAGCTAAAACTTCGTCAGACCCTACAAGCATGTAAAAAGTAAAAAGTAATATCTGTGAAGCCACA
TTTCGTTCATTTCTGTCAGTTGTCTTGGCCAGCCGGGTGCGAATGAAAGCTGCTGGTAGCAACAAGCACGAGCTTGTGCTTCGCGACAAATCCAGCAACA
TCAAAATTCGAGCGTTTTTCAGTTAGGTCGTCATCCGGCGCATCGGGAGCACTTCCTTCCTGGCGGAAAAGCAGCGAGACGTAGCGGTGTTCCCCCACGG
GTGGTGTCACCGGGTAGTACGGCACTACTACTACGTTTTGCGGCTGGTCTTGAACACTCTGCCCGTCCACAGCTAGGCCCGCCAAGATGTAGTGCAGGAA
CGGCGCGTGCGTCGGAGACTTGGGATCCGGAGCATCAATGTCGATCAGCACGTACGTGTAGCGCCCAGCACTGCCAGCTGGGCTGCCTTCAATAGAGACA
CTCGGTGCTTCTTGAGCCTAGCAGTCAAGACGAGCATGATGTGAGACTTGCACTTCGTCCAACGGATTAAAAGGTAAAAGATCTGGTGGTGCCAACCTCC
TTCATGGGCACAAATTGCCCCAGGGTCACGGGGTGGCCGCCATTGAACGCGATAGCGATATGGGCACTGCTCCCGTCCTGGATTTGGAGCTGCAGCTGCT
GCAGAAC