Description :
From Genome Similarity Track
Location :
scaffold_677:13019- 16392
Transcript NameFunction/comments
Pl_103024pol protein

Sequence
3373 bases(100 bases per row)
GGGGAGTACAGCCATCGACAGGCTCGTACTCCTGCTTCAGTGCGGCAAGGCCACAGCGCACCAACAGGTGCGGCACATGGGGCTCCCGCAAGCGGGGTCA
GTGCAGTACCCATGGAACTGGGTGTTGCCAATACCCATGGAACTGGGTGTGGCCAAACAATGCTCCATTCGACGCTACGGATGTGGAAAGGTTGAGCACA
TGCAACGTGCCAGCTCTGTTGGCGGGTAAAGGAAGTACTCTTCCAAACCCAAGGACTCTGAGGGTCATTAGCAGAAGCCACGACCTGAGGCTCAGGGGAA
CGGAAGTCACCAGTAGGGGCGGATCGCCCTACTGGGGAAGACCTAAGTCTTCGGGAAAGACGTACGGACGGCACACATCCCGGAGGCTTAGTCCCAGAGA
TTCTCGGTGCTCTCGAATCGAGAAAAAGCAACGGCGAACTGATGGTGGTACACGCGAGTGCACGGGGATACAATTACCCCTTTTGAATCCTGATCGATTC
AGGTGCGTCGAAGGACTTCGTGCACCGACAATTGGTCACTTGGAACAGCAACAAGATTGCTGACGCTCTGCGTGAGAATGAAGGCAAGGGCCAGGTCTCG
GTGAGACTGGCCACGGTACAGTGGTAGAAGTACCTCGGGTCGACATGGACCTAGCTGTACAGTTCGAAGCTTTTGACAGCACGGAGCAGGTTCTTGTCCT
CGAAATGGGCAAGTATGATCTGACCCTGGCCTAGAAAAGCACGAGCTGTGAATAGACTACAGGCTCTTGTCCTCGAAATGGGCAAGTATCATCTGACCCT
GGACTAGAAAAGCACGAGCTGTGAATAGACTGGCGCGGCAAAGCCATTGGGGTTAGCCGGCCCGCGGTTTCGGACAGAGCATTGGTGAGTCATGTTCCCA
CCTCTGCTAGAAACTGGGACGCCCATAAGTGTTTCCATGACTCATCGGCGTCTGAGAAAGTAATGAGAGTCGCTGACTCCACTGATGAAGTTACGGTGGG
CACTGCAACGGGTCCTGGGACCGACGCTCACTGCCGAGCGTGTGGAACGGCGACATTAGTAGCTCCCAACGCTGAAAGTTGTCGTCCCGGAAGGGCTTCG
ACTGTGACAGTACCAGAAGACACTGGCCAGGTGGGTAACGTAGGTACACAAGCGGATAACGTAGTTCCGCATGCAGCTCTTGCTGCTGTGGAGCGCGCTA
AGATCTTCTGGAACGTGGGTAACCTAGTTCCACGTGAGGTCGAAAAGATCATACCGAAAGAAGAGATACCGTCGAGTATTTCCTGTGTGAGTAACGAAGC
ATCACACTCGGGGTCTGAGACCACTGACCCAAGGTCGGTCGAAGAGCAGTACATCTTCGACGGCTTGACCGGATGCCGGGTCAAGGCAGGTCCTTTCCAT
CTGAAGGCACTGCCTGAGGCGTCAACATTGCTGAACGTGGAAGTACTGTCCATGAAGGACTTTCTGGCCGAGTTGAAGGCCGGAGGAATCGAGGAGATGG
TGCTCTTAAAGCCGGAGACCACTCCTCAGGAATTGAACTTTTCCTCCGTCATGGACGAGGATGTCCTGGAAGGGTTCACGAAGCAGCGGCCGACGCGCTA
TGGTTATGAGACCCTCAAGAACCTGAAGGATTCGGTCTATCCTTTAGTAAAGGAACTCTCGGATGTAGTGTCGAAACATCCACCATCTCAACTCCCACCG
GGTCGCGGTGTTCGGCACGAGATCAACCTCGCACCTGGCACCAAGTACTGCGTGGCCTCTACCTCGCGAACAGTGCGAGGTAATTGATGCCTTCTTCGCA
GACAAAGCGAAGGCAGGCATGGTGCGGGAATCAAAATCCCCGCACTCGACACCGACCTTCTGCGTTCGGAAACCGAACGGGAAGTGAACTCGACGCCAGC
CTTCTGTGTTCGGAAACTGAACGGGAGGTGGCGTCTGGTTCACGCTTACAACAAGCTGAACAATGCGTCGGTACCGGCGCAATCGCCGACCCCTCCCAAA
AATGTTTTGTTGTACAACACGGCAGGTTGGACGCTGTACAGTGCCTCGTATCTCACTACGAGATCCTGATGCGTGAGAGCGACATCTCACTCATGGCCGT
AAGTACACCGAGCGGTATGCTCTGGGAGTGGCTAGTGGTGCCACAAGGGCTCTCGAATGTCCCGGCGACGTTCAATCATCTGGTCACGTAATTGTTCAGA
CCATTGCGTGACATCGCGCAAACATACTTCGGCGACATATTCGTCTATAGCCAAAGATGACCAGACGGCTGTGGAGGTGCATTTGAAGCATCTCCGTCGA
GTGTTTGAGGTCATGAGGGCCAACAAACTCTTTGCTAACATTGACAAATGTGTCTTTGCGGCTAAGGAAATAAAGGTCCCCGTCTGCTTTGTTAGCAGGG
TCGGTGTACGTGCAGACCCGGAGAAAGACAAAGCCATAGCGGCATGACCGACTCCAAGGTCTCAATAAGACCTGAGGAAGTGTCTGAGGCTAGCCAACTA
CCTCCATAAGTACAGCGCAGGGTACACTGCCCTTGCTCGCCCCTGTCGGATTTCATAAAGAAAGATACCGACTGGGTGTGGGAGCAACAGCACCAGAATG
CTTTGAAAGCATCAAAACGAGCCTAGCGTAAGCGCCAGTCCTGGCTTTGTCGGACGAGACGAAGTCATTCGGCGTCGTCTGTAACGCCTCCGACTGTGCA
ATCAGCTTTGCTCTGTTGCAGGTTGATGACGAGGGACGAGAACGAGTCATCTCGTTCCAGTGCAGGCAACTAAAAGGAACTCCCCCATTCACGTCAAGGA
GCTACTTGCGATGAAGTATGCCCTTGTCATATTCCGAGTGCACCTCTTGGGCTCGAGGCCCTCTATGATCTACACCGATCACGCGTCCTTGCGGACTGCC
ACCAACTCGTTACACCTCTCACAGCGGATGGCGAGGAGGCTGTCATTCTTCTCGAAATATAACTTCCGCGTCGAATACAAGTCGGGTAAGCTCAACGTAC
TTGCCGACGCTCTATCGCGTCGACCCGACTGTGAGCTAGCTCACATTAGTCGGGTCACGACTAATCTGTACGATCGGATACGCTTGGCGTATCAAGAAGA
CAAGAACTTCACGCCTCTGGCGCGGCTCTTGTCTGAAGGCAAGGATGCCAAGGTCGATGGGCTATCGCCTCGATAGTGGTCACAGCTCCATCGATACAAG
ATGACTGGTGGCTTGCTCCATTATAGCGTAGAGCCAGGAAATCCTTTTCGTGTCATCGTTCCGAATAACGAGGAGCTGAAGTATGAAATACCTTCTGAGG
CACGTCTAGTGGCCATCCTAGCCGAGAGAAGACCTACCAGTCGGTCTCTCAGAGGTTCAGGTGTGGCGACGTG