Description :
From Genome Similarity Track
Location :
contig_43:130170- 131917
Transcript NameFunction/comments
g6338.t1hypothetical protein

Sequence
1747 bases(100 bases per row)
CGTGGCAGGAGTAGCTACCTCCTCCAGCTTCTGCCTCTTGACGTCAAACGCCTCCTTTTCGGCCGAGTGGTTGCCGTTCAACCAATGCAAAGTGTCCGTG
GCACTGTCTTTGATGCCTGCATATCCGCGATAGAGCGTTTGAGCTCGGCGATATTCGCAGTTGCAGAGCTGCAAACAGCGTTTGCGTAGCTTTCCAACGC
TGTCTTGGACCCAAGGCGTAACTCTTCACGTGCATCGGTGCCAATCGAGAGATTCTTTTCTAGGCCAGTCGATATCTCCTTGACCGATACATTTACAATG
TCGTCCGCGTTAATGTCGAGTGTTACCTCGATCTCAGATTCGCCGCGCGGCTTGAGCGGAATATTATCCACTTCGATCGTCCCAAGAAGGCAGTTGGCAC
TCACATCTGAATGCTCTCCTTCAAAGATCCGAACGCGCATGACTGCCTGGTTGTCCTCAGATGTCGAAAACGGTACCGTTCTCTTTGTTGGGACAGTAGT
GTGCCGATAAATGACCACCAAGCTGTTTGTGCCGTCTACCTCGGCCCAGAGCGACAGCGGGGTTACATCCAACATAATGAAGTCATATAACGTCGGAGAA
GCCACGCAATTCAGGATGGCAGCTTGCACAGTGACACCGAACGCTGCACCCTCATCAGGACGAATTGGGCTCGAAAGTGCCTTGTCGCTGAAGAAGTCCT
TCAGCAGCTGCAACATCTTCGGACTACGCGCGGAACCACCACTAACAACCACCTCACGAACTCGATCCTTTGCCACTCTGGCATCTCTCAGCACCTTTTG
CACAAGTTGCAAGGCCTTGTCAAAGAGATCAGCGCTTAAGTTTTCCATCTCAGCGCGTGTGATCGTCGCGTAGTAGTCGATCCCGTCGTGCAGCGCGTCC
AGCTCAATGTACGTCTCCGTTGAAGACGACAAGGCTCGCTTAGCCTGCTCACAAGCCAAGCGCAGGCGAGTGATTGCACGCAAATTCACCCGTAGATTCT
TGTCATGAACTCTCTCAAAGTCGGTCACGCAATGCTCGACAAGGCGGTTGTCCAAGACCTGCCCACCCAGGCGTGCGTCTGTCACCGCGGCCTTAACTTC
GTAGATGCCCTGCTCAATGGTCACCACGGACACATCTAACATCCCGCCTCCCAGGTCGAACACTAGCACATCGTGCTCGCCGTCTGTCCAGTCCTTGCCG
AATCCATAGGCGATAGAGGCGGCAGTCGCAGGGTTGACAAAGCGCAACACGTTGAGCCCAGCAATTTCTCCCGCGTCCTTCATCGCCCGCCGTTGCGATG
GTTGAAGCAGGACGGTACGGTCAGCACCACCTCCTTCACTGTCTTGCCAGTGTGTTTCTCTGCAAGCTCGCGTAGTTCGGCCAGCAGCATGGCCAGGATC
TCTACAGGCTGGAACGTCTTGGTCTCACCTCGGAATTGCACCTCCACCTCGGGGTTATCGTTCTGTCCACAGATCACTTTGAATGGCCAATGTTTCATGC
TTCTCTGCACTTCTGGGTCGGAAAACTTGCGTCCGACGAGTTGGTTCATCCCAAACACGGTGTTGCGAGCATTCCTTGTCAGTTGATACTTGGCGGCGTG
GCCGATCAGCCGCGAAGTCTCCGTAAATGCCACGTAGGACGGCGTCGAATAGGACCCATCGCAGCTCGGGACGATCTCCACGCGGTTGTTCTGCCACACA
CCTACGCGCGCGAACGTCGTGCCCAAGTCGATGCCCACGACTGGACC