Description :
From Genome Similarity Track
Location :
contig_19:130136- 131138
Sequence
1002 bases(100 bases per row)
TGTGCGTTTGTCCATGTAATGAGGGTTGCACCGAATACCCATCGACTCGGTACACATACGTCCTGGCCATCATTGGCGTCCCCAGAGAAAACGAAAAGTT
GCAGCACATGAAGTTCTCCGAGGTGAGCACGATATCATTGAGTGCAACTGGTACATGTCGGCACGCGAGTCGGCGAAGACCTTCTGGTGTGGCCACAAGT
TGTGGCCTCCATGTGCTGCACGTTGTCCTGGCAAAAGTAACTTTTTCCGCAATTCACTCCCGATTTCGCATTGGCGCTGCAGGCATCGCGCTCGGAGACC
AACACCAATGAATCAACATGCAAATTCGGGTGACTCAGCTTCGCGCGCACCACCTTGCAACAAAAAGATGACAAACCGCAGAACTGTGGACCTGGCCATC
AAAAGCTTTACAAGAAGCGAAAGTGCACCCCAGGTTTGTCAATAAGACAAAGCCTCCAATGATACCAGGATTCAATAGCTTCTTAGTTAAACATACACAG
AGGACCCAGTTAGACTTTGTGGCTCGTCGTCGAAGCCAGAAAATAGAAATCACCGCGCTGGTCTGCAGTGCAGCATCGATGTTTTGGTGGCACCGAAGCA
GCAAGCCAACGACGGCAACTTTGGTCCGAAATTTTAGCGGCCTCGATCGCACCGGGCTCCTTCCTTCCGGGGGTAGCTGGCACGTGCGGTGTAGCGCATC
TTCAGAGTGTTACGCTGGGGATGTTCGCGCTCGGTTCCTTCTCGATTCCTTTTTGACGGCTCACTCGTCACGCGTTCGACGCTGAGCGATGATTCCTTTG
GCCCGTGCAGACCCCTGATGCCGCCGCCCGCTGTCCACAACCATAGCGAAGCCCCACGGTAACGCAGCCAAAGCCGGCAGCCGAGGACATTCCTGCAATC
GTCGCTGGCATCGTTTACGGCAATGCCAATTTGGCATGGAGAGAAGCGACCGCGCACTGTCAACAACCACAATGACGACCCAAGTGTGGAGGGAGCCAGG
GA