Description :
From Genome Similarity Track
Location :
Scaffold_29:1301069- 1306051
Sequence
4982 bases(100 bases per row)
TACGCTTCCTCATATACGTGCGCAAGCGTGTAAGCCGAAGTAGTGGGCTTAAAGTAGGTCTATTACACCTGGTAGCACTTTGTAGTCCGTTCAACGACCG
ACTAGCTAGCGAGTTCGTATGGAATACGAACACGGGGCGGAGAACTAACACATGGACAATAATCCGTCCATGCGGAGCCCGAATGCTTCTGCCACGCACA
TTGTGCGTGCAGATTGTCCCCATCTAGAGGGATAAGCTTGCTCTCTTTCTACACGTAATTACTCACGTGCAGTTTCAACGACTGCACGCAGTCGCTGTAC
ACTCACGCGCAGAGTGTCCAGTGTACCTACATCGATATCACCTCACTTGTCCCCCAGTACGCTGTTGGCGTCCAACAGCGGAAGCGTTGCACGTATGCGA
TATTCAAGGAGGAGCTCAGACAAGCGTTTGAGCCCCCTCAGAATGAGTTCCTGTCGAGAGCAGAGTTTCTCGACCTGCAGCAAGGTGAGCATGACGTTCA
TGCTTACGCCCAACGTGCCCGGTATTTGGTCTCAAACATCGAGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATAAAGGGCTTGAAGGAT
GGGTTGGTTAAGACTTATCGCTTCCGAGAGTACCTAAGAAATTTCGAAGCTGCGGTTGCTCTTGTGATGTAAGAAGAGTTTAGCCTGAAGCAGGCTAAGC
TGCATGCGAGCGTGCCAAGGACAGCACGTCCGACGATGAGAGAGGGAGGTCCAGAGCCTATGGCCCTCTTGAACGCTTATGCTATTGGACGCCAACAGTG
TACTGGGGGACAAGTGAGGTGTTATCGGTGTGGGTACACCGGGTACTTTGCGCGTGAGTGCACAGCGCCTGTGCACTCGGCAAGGGGCGATTTGGGGCGT
CGTCGCGTGTTATCAAAACACGTGCAGAGCCAGTAGGCGCGGATGGCCCTACTGGTATTGCGGTCGCGCGTGTCTACAACGGGCACGCGACTCTGAGGAC
TGCAGCCCCAGCGAGAGGGGTTCTTGCTGCAAGACGCGAGATGACAAGCCAAATCTTGTCATCCTGAAAGTGACTTCGAAGAGAGCAGGCTCTATTCGTG
CTTTGGTTGACTCAGGTGCGTCGAACAGCTTTGTTCGACTGGACAGTCTCTTGAAGAAAAACTTCGAGGAAGTTAAAACACCTCGAAGTGTTTTGAAGGT
GCGGTTGGCAACAGGTGCCACCGTAAGAACGGAGAAGTGCGTAGCACGCGTGCGCTTGCCGTACAAACACCGGGTGTTTGTGGAAGATCTTATCGTTCTA
GCGCTGGACGATAAGCTTGACTTGGTATTGGGTATGCCGTGGATTGCACGGCATGATCCAGGGATCAACGAAGAGAAGTATACACTTTTACACTTCGGAC
GCAACGCGAAAGAGAGCGATGGCCCTGTCAGTGTCGCGCATGCACTGCGAGGTGCATCCGATCACACCGTTGTGGCAGCACCTTATGATGCAGCCTCCGG
TGCCCATTCACAAGTCGCAACGACTAAGGCAGTCGTTGGGTATGTCTCAATTCGGAAATCAGATTTAAGACACGTTCATACTTCAATGACCGTATCGACT
CAGGGAGTTGATAGATCAAGTATGAGGGAGCTTCAAGTCACATACAGTAGCTGTGGTGTCGGCGTGTCAGCTCCGGGAGATGACACGGTCGTGATTGGTT
TAAATTCACGAAGGGCTCCGCCGAAAGGCGTCGAGGTGATGGCAGCGCGTCAGCTCCAAAGGTTGACGACGCGGCAAGCAGTGTTGGCGGTTGCAAACGT
CCAACACTGAAAACGCTTGCGTGCTCGCGTGCAGACGGGCTGCACGTCGTAGCGGAATGCAATCAAGCCGGGCTTGATCATTCGCGTCCGCGGATAGAAT
CCGCCGACGGTTACAGCGGTAATCCGTTCAAGGCCGGGTCTGGACGGGAAACATGTAAAGCCGGACTTCACAAGAACAAAAGACGGCGCAAGCGACGAAA
GCTTCGCAAGTCTTGGTCCGGAGCGAGATAATACGAGCGATGTCCGCCGGGCAAACATTGGAGACGACGTCGTGCGTCGAGACGTTGATAGTCTTGACGC
GGACCAGTACTGGCCTCCAGTACCGGTCCATGCAACTGGAGATTCCTCCGACGAATGCGTCGGAGCTGACGTCGCTTGTAGCCATGGACTATATGCGCTT
TGCGAAGGACCTGTACGATGAACGAATCGAGCAAATGTGCATCCTTTCGGATATCTAAAGGGTGGAAAGCGAAGTGGAGGATCTGAGGCACCTCCACACT
GGTGATACCGCTGAGAGTAAAGACACTCTCAGCGAGAGGACGAAGAATCAGTGCTTCGACGAGCAGAGCTGGGACTCATTGAAGTCGATTCCCTTCTATG
ATGTTCTGCTGGAGCACAAGGATGTGATCCCGGAAGAGATTCCGCAGGACAAGGGCATACAGCACGAGATCGACCTCGTGCGGCGAGCGAAGTAATGTGT
GAAGCGGCAGTGGCCACTACCGCGTGATCAAGTAAAGGCAATCGATGACCTCTTTGAAAGTCTTCGTAATGCGGGTCAAATATGGGGATTAAATTTCCCG
TACAGCGCACCAACCAACATCTGTGTCAAGAAGCCACAGGGCGGATGGCGCATCGTTCATGCTTACAGCAAGCTGAACGATGCAATGATATCGGGCGGAC
GCTGATAACCCACGAAAAGATGTTATCATTGATTCGATGGCCAAGAGCACCATCTATAGTACTTTTGATCTGCGCCCACGGGTTCTATCAGATCCTGATA
AGTGAGAGGGACATTCCTCTCACAGCGGTGAGCATTCCTAGCGGTATGCTTTGAGAGTGGCTCGTAATGCTGCAGAGAATGAAGAACGCCCCTGCAACCT
TCAGTATATGTGTAACACAGCGCTCAGTGCGTGACTTCGCACTGAGCTACTCCGATGACGTGTTCGTTGACAGCCGGGCTGTGAAAGAGAAGACTGACGT
TGAGGTGCACAAAGAGCACCTCCGTCCGCTGCTAGGGCTTATGCGTAAACATCATCTCAATGCGAACCTGAAGAAGTGTATCTTTGGGGCGAGCGAGATA
CCCGTCCTTGAGTGTCTCGTCGGGGAGAACGACGTACGCCCTGACCAAGAAAAGGTCATAGTGATCAATGAATGACCTACGCCATCCAACGTGAAGGAAC
TGAGACAGCTCCTTGGACTTGCATCGTTCTTGTGCAAGTACGTTGAAAATTACGTGGGCAAAATACGCTCGCTGTCACAGCTCATGAAAAAGGAGGCTGG
GTGGATTTAGGCTGCATAGTGTCAGCAGACCTTCGATACAGTCAAGCAGGGCTTGACTGAGCCGCCGATCTTGGCAGTGACCAAGATCGCCCATTCCACA
TCGTGTGTGACGGTCCGACTTTGCAATCGGATGCGCGTTGATGCAGCACGATCACGAGGGCCATGATCGTGTGGTAAAGTACCAGCCGCGTCAGCCGAAG
CCAGCTGAGCGTAACTACCCTGTACATGACAAGGAGCTCCTTGCCATGAAGTATGCACTCGCGAAGTTTCGAGTGTATTTATTTGGGAGTAGACCGCTCG
TAGTCTACACCGACCACGCTTCACTGCGAGCAGCAGTGAAGACGCCGCACATCTCGCAACGAATGGCGAGATGTTTATCGTTCTTTGCGGAGTACGACTT
CCAGGTTGAGTACAAACCTGGAGGGTTAATTGTGGTGGCCGACGTGTTGTCGCATCGACCTGATTACGCTGTTAAGACAGCCGACGTCAATCAAATTGGC
GTCGAACGAGTAAGTGTTCCGTCGTCGACATTGATCGACGACGTGAAGAACACGTATGTGAGAGACGCAGACACGAAACCGCTGCTAGACTTTGTCTTAG
CACCTTCTGACGTATCACGTCGGAAGTTGTCGCCACATCTACGAGCTCGTGCGCACTGATATCGTGTGCACGAAGGACTGGTGCCCTACAGCGCAGTGGA
CGATGATGCGGGTCGCATCGTCGTGCCGAATGATTATGATCTGCGTCTGCGGATCACGTACTAGTACCACGATGCCCCCACGGCAGGGCATCCGGGCCGT
GAGAGGACATACACGCTTCTCACGAGAGACTTCTACTACCACCAGTACAAGAGGGTGCGCAAGTACGTACGTGCTTGCGAAGTGTGCCAACGCGTGAAGC
CTGTTGCGTATTCGCAGGCTCCACTCCAATCACTGCCGACAACGTCGGAGTGCTGGCAGTCCATTTCTATGGACTCTGTATTCGGTCTTCCGCCAGACAA
CAAGCGGAGACTGACGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG