Description :
From Genome Similarity Track
Location :
contig_19:130106- 135201
Sequence
5095 bases(100 bases per row)
AGCGCGATGCCAGCAGCGCGCGCGTCGACCTGTGCGTTTGTCCATGTAATGAGGGTTGCACCGAATACCCATCGACTCGGTACACATACGTCCTGGCCAT
CATTGGCGTCCCCAGAGAAAACGAAAAGTTGCAGCACATGAAGTTCTCCGAGGTGAGCACGATATCATTGAGTGCAACTGGTACATGTCGGCACGCGAGT
CGGCGAAGACCTTCTGGTGTGGCCACAAGTTGTGGCCTCCATGTGCTGCACGTTGTCCTGGCAAAAGTAACTTTTTCCGCAATTCACTCCCGATTTCGCA
TTGGCGCTGCAGGCATCGCGCTCGGAGACCAACACCAATGAATCAACATGCAAATTCGGGTGACTCAGCTTCGCGCGCACCACCTTGCAACAAAAAGATG
ACAAACCGCAGAACTGTGGACCTGGCCATCAAAAGCTTTACAAGAAGCGAAAGTGCACCCCAGGTTTGTCAATAAGACAAAGCCTCCAATGATACCAGGA
TTCAATAGCTTCTTAGTTAAACATACACAGAGGACCCAGTTAGACTTTGTGGCTCGTCGTCGAAGCCAGAAAATAGAAATCACCGCGCTGGTCTGCAGTG
CAGCATCGATGTTTTGGTGGCACCGAAGCAGCAAGCCAACGACGGCAACTTTGGTCCGAAATTTTAGCGGCCTCGATCGCACCGGGCTCCTTCCTTCCGG
GGGTAGCTGGCACGTGCGGTGTAGCGCATCTTCAGAGTGTTACGCTGGGGATGTTCGCGCTCGGTTCCTTCTCGATTCCTTTTTGACGGCTCACTCGTCA
CGCGTTCGACGCTGAGCGATGATTCCTTTGGCCCGTGCAGACCCCTGATGCCGCCGCCCGCTGTCCACAACCATAGCGAAGCCCCACGGTAACGCAGCCA
AAGCCGGCAGCCGAGGACATTCCTGCAATCGTCGCTGGCATCGTTTACGGCAATGCCAATTTGGCATGGAGAGAAGCGACCGCGCACTGTCAACAACCAC
AATGACGACCCAAGTGTGGAGGGAGCCAGGGAGAGCTGTTTTGCCAAGGTATAACCGTACAGGTATGTAGTATAGCGACTCGGGGTCTTGCTTGAGCGGT
TGTTGTTGACATCTAACAATGGTGCCTCAACCCAGCAAACGCCCCCACTTTGTACTGTAGGTCAAAGACGATTGCAACCTGTACTGGACGTTCGTTTGCG
TAACATCACCAGCGATGGTATGTTTGGCACGCTGATCTCTCAGAGGCAAGCACATTCTCTCGTTTCTCATCAGAGGCAACAGTTTCGCCTAGATCACTCG
TTGGCGTACTTACCTGCTACTGCTTTATTCTCACGTAGTCGTTGTCACAGGCCCAAGTCGTTTCCAGCACCCTCAGTGTCTGATGAACTAGATACCCACG
GGTCGTCCACACTGTACTGACCACAAAAGTTTCATCCCAGACCGTGAACGAAAACAACTGTACCATTGGCGAGGTACGGTACGGTTGCTAGCCTCAACAA
ACAACAGCAGCGTGTCTCGAAGCAAGTGCTTCCCGGCACGGATACCCGTCGCATGCACGGTCGTCTGCACGGTTCACAGCCAGCTCACTGTGATTGCCTG
GACTCGAGTTTCGAGCCAGCTGCTCACCTCGTGGTTACCTGGAGCATGGAGGATTTCTCTCTCCTCCACGCGAAGAAAGAGCCCTGGCGATCACCCCTGA
TCTTAGCAATGGGCTACACGAAGTGGTGGTTTCTGTGGCTTCTTCTGTGGCTTCTGCTCAGGTTCTTCCAGTCTGCTCCGTTCTAACGCATTCATGGCCA
TGGACAGATAACGGCGAATGATCTCGCCTTGAACAGATAACGACGGATGATATGTATCCTTGAGCAAATTCGGCTTTCCGATCAGTAGTGATTTGTTATA
CCTTTTCCATTGTGTGGAAATAGTAGTATGTGGCTGCGCTCAGCACTTACTTATCCGTTAGCTTGATTTGCGGACGCTAAGTCCTCCGAGCCGGGAGCCC
GTGCTGCCGAATCCCAATGCAGGCAAGCCCTCGCTGCTCTGTTTCGGATGTTCTATTGATTCTATTGACAAGGCCAGCCAGCGAGACCTGGCACTCAAAG
AGCAATGGAAAGGCCTTGTGTCGACTTTGCCGAAATCGACGGAGGGTCTTGTTTGTGAGGTGTCGGAACTTGCTTGTGGACGGTTCTGGAGGTTGTAGTT
GTTGTAGTTGATGCGCGGTGTTGAGGGCAAAATGCAGAATGGTTATATTTTTTGTTTTGTTTTCGTGCCCTGTTGTTTCTTGCTTTCCTAGGGCTCCGCT
CTAGGAACGACACCTTTCAATACATACACTAAGTCTTGGTTGTCTTCTTCAACCTCTTGATTATGGTCGTGGCGATGCTCGCCGTTGGCTTGAACGCTGG
GTTCGCGTGGGTTGCAGATTTGCAACATGAAGCGCTTTGCTGGCAACCTGATAGTCTGTTGCACGAGCATGGGCTGCGAAAGCTTTCCTGTTGACGCCAC
CACCATCAACGAGTGTGTCATGGGTTGTTGCCGGTGCGACTCGACTTGATTGTCCGCGAGTCCGAGCGCTAGCGTGGCTTGCGTTGCGCGCAGCCAAAGG
CTGACAATCTCCCCTAGAAGAATTGCTCTTACTGCGTTGCTGCTCCCGCAGCCCCTTCAGTAATTGATGCCAATGAACGACATGTTTGATGTCCTTCTCT
AATTCCCATGTACACTCTGACATCGGCTCACCAAGCCACTTGACGAGATACTCTGGCTTTCGGTTAAACTGCCTTTTGGCAATGAGCCGCTCCACAATAC
GCATACCGTCGTCGACAAGTTCATCGGGCAGTTCTACTGGGGTGTCCTTGAATTTTGGGCGCGAGCGGAACCGTTCGAACTGCTCTGGGTACGGCGAAAG
GAGGTCGACATTGAAGGAAGGATGAATGCGTCGAAATCGCTTTGGTAATTTGAGCCTAGCCACGTTTTCATTCACCATGTACTCGATGGCAAAAGGTCCC
ACCAATCGTGCTGCCAACTTTGCTTTAGTTAGCTCCGTGTTCTGAGAAACATGCTTGAACGATAGATGCTCGGTTTTCAGCAGTACCTGATCACCAGCTT
TGAAGTCTGGTTCCGACCGACGCTTGTCGTAATACTGCTTCTGTTTTGTTTGGCGTCAAGAAGAGCTTGCTGTGCGCGTTCAACAATCACACGTCGGCGC
TCAGCAAACTGCCGAGCAAATTCTGCCTTGGTACGTACTTGGCGAACAGTATCATCAGAATTCACAGCTCCGGGGTGCCGTGCAACACGACCACAGTCAA
TCTCGAATGGTGTCAAACCCGTTGATCTACTCACCAGCGTTGCGTGCGCGAATTCAATCGTGCCTAACAATTCTGACCAGTCTGAGCCATGAACACTAGT
CATGCAACGAAGGGAGTCTTCCAAAACTCGATTTTGCCTCTCCACTTGACCGTCCGCTTGTGCACGGTGTGCCGTAGTCATTCGTAATTTTACTCCCATG
ATCTTCATTAGCTCTTGCCAAAAAGCTGCTGTAAATCGAGAGTCACGGTCGCTCACAATGACTTGAGGCAAGCCATGGTGGCGTACAACTGACTCAAAGA
AGATTCGTGCACAGTCGGCTGCAGTTGCTGTAGAGTGCATGGGTGCATACTTAGCACGCTTCGAAAGGAGGTCAACTGCAACTTGGATGCAATCAAAACC
GTTTGACTCTGGTAGACCAGTGATGTAATCGACGCCCACGTGTTCCCAGCATTCCGATGGGATTTCGAGAGGTATCAGCTTCCCTTTCTTCTTGAGGCTC
GACACCTTGAATTTGTTGCACGTCAGGCAGCTTCTTACGTAATCGTTGACATCAGTCTCCAACTCCTTCCAATAGTACCATTGTTTCACTCGAGCTAGCG
TTCGTGGTACGCCTGGGTGTGCTGCACCATCATGGAACTCAGATAAAACTTGCGTTCGAAGCTCATAGTCATGTGGTACACAGATAGCGTCCACATTACC
TTCCATTTGGCGATACACAATGTCATCTTTCCGATAAAACAACCCACCTTCCATACTTCGAGGTGCATTGTCTAGAATCGGGCTGAAGTCTGCATCTGTA
CGATACCCAGCAATGAAGCGCGAGCGCATTTGTCCGGATAGCGCAATCGCTGTAGCATACCGTGTAGTAGCGTGGACCTGAACCGCAACCTGTTCTTGAG
GTACAACAGGACTCCTGCGGTCAACACTCACCCCTCGTGATTGATCATCTAGGAGAAGATGCAAGTCATACGAGTTGCGAGAGACAAGCGCGTTCATACC
CGTTGGTGATCATCAATTCGTTTTTGGGCATGACTGCATGCCTCAGAACATGTGTGTATATCGACAGTGCTCACTTGCACAGCATGATCATCGCTAGTCC
CCTGTACTTCATCTTCGACAGGTTCATCACTAATCTGCTCGTCCAATTTTGCCTGCATGTCTTCAGGGTCACCTGGAAGGTGGCGCGACAAAGCATCGGC
AACGATATTTTGAACACCTTTCACATGATGGAGTTGAAAATCGAACTGTGCGAAAAAGTCGAGCCACCGTGCCAATTTAGATGACACTGTCGGGTGGTTC
AGGAACCATCGGCATGCAATATTGTCTGTATACACGTGAAAATGACGCCCATGCAAATAGTGGCGCCACTTGCCAAGTGCAAGCTTTATCGCGAACAGTT
CTTTTTCGTGAGCTGGCCAATTCAACTCGTGATTGCCCAATTTCTTGGAGTAGAAGGCGACAGGGTGGTCAAAACCGTCGTGCCGCTGAGATAGAACGCC
CCCACAGCACTGCTTAGACGCATCGGTTGTCACAACGAACATCACGTTGAAATCCGGCAAGCGGAGAATCGGAGCTTGCTGTAGTGCTGCCTTAATTACC
AAGAAGGCATTTTCTTGATACGGAGTCCACTGCCACGTTTTGTCTTTCTTAACGAGATTGCTCAGTTAAAACGATGTCAGCAAACCGATGAATGAAGCGT
CGGTAATAGCCAGCAAGTCCAAGAAAACTCTGCAGTTCCTTTACCGTAGTTGGCGTTTTCCACTGCTCGATAGCTGCAGTCTTCAGCTTATCGAC