Description :
From Genome Similarity Track
Location :
Scaffold_1390:1301- 2866
Sequence
1565 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACGTACGCCACATCAGGTCTGGTGCACGTTGTAATGTACAGCAAACAGCCAGTGAGTGCTCGGTAGGGC
TTCGCCTGCATTTCCTCACGTTCCTTCTGAGTCATCGGCGACTGAGTCTTCGACAACTTCATGCCCGACTCGCACGGGTTCACCACCACCTTGGCGTCCT
GCTTGTTGAACCGCTTCACCACATCATCAATGTATCGAGTCTGCTTGATCATGAGAGTCTTCGCCGATGAGTCATGGTCGATCTCCATACCGAGAATGAA
CTTGGCCTCGCCCAACTCCTTCATCTTAAACGCATTCTTGAGCGCCACCTTGACTTCCTGGATCTCGTCGCTCATCTTGGCCGCGATGATCATGTCGTCC
ACGAACAGGCAGACATACACGAACCTGCCCTTCTCGCCTTTGACGTATACGCACTGATCGCCGCAGCAGCTCCGAAATCCGATGCCCACGAAGACTCGGT
GGATGGTCTTATGCCAGGCATTCGCCGCCTGCTTCAGACCATAGATCGCCTATTGCAACCGATACATCATGTTCTTCGCGTTGATGATTCCGTAGGGCAC
CTCCATGTAGACGCGCTCCACCAGCCCGGTGTTGAGAAAGGCGGTGTCCGCATCCAGCTGCTCGGTGATGTACGCCTCGGCCACCACAACCGACAACACC
ACTCGGATCGAGTTCATGTTGACCACGGGCGAGTACGTCTCGAAGAATTCCACGCCATACTTCTGCTTAAACCCTTTCGCCACCAGGTGGGCATTTACTG
GATGACTCGGCCGTGCTCGTCGCGTTTCTTTGCGAACACCTAGCGACAACCGATCGGTCGAGCACTCGGTGTCCGACGGACCAGCGACCATGATCCGTTG
TCCGCGTGTGCTTTGAGCTCCACATTCATTGCCTTCACCCACTCCGACGAGTCGTCGCTCTGCATGGCCTGCTGATACCTGGTGGGTGCGTCATTGGTAT
CGCCGATGTCTGCGGCGTAGGCCAGCACCGCCTCAGCCAATAGGCTGTCTTCGTCCACCCTGGGT