Description :
From Genome Similarity Track
Location :
Scaffold_440:1301- 2626
Sequence
1325 bases(100 bases per row)
CTGATGCCGACTTGGATGTAGTGGCGGATCCGGACTTGGATCCGGCACCAGACTTCGAGGGGAAGGCGGAATGTTTGGACGTGGATGTGGATCCCGCCTT
GAATGTAGATGTGGATTCCGCCTGAGAGGCTGCCTTAGAGGCCGAAATCGTTTTGGGCTTGGCCTTTGGGGAAGCTCGGCCATGCTTGTGAGGACGGGGG
GATCCAGTGCTAGGAGCGGGAGATGCACTACGCGGTCGTTTCGCAGCCGACGGATCCGCCCCACTTACAGACGGTAGAGAAGCAGAAACGCTGGCAGCAG
GAGAGGGCCCAGACAGGGGAGGAAGGGGATCTGAGACAGCAGCTGTCACCTGCGCCAGTCGTCGGCGTGCCAAATCCCGCTCCGATAAGGCACGATCGCT
CTCCAGAACTAGCTGCTGGTGCTGAACATGAGCTGCAGCGAGTTGATCCCGGCGTTTTGCTGCGATTGCCTCAGCATCCTTCAATTTGTCACCTGGATCG
ACATAACAGGTGAATATGGGGTTACTAGCGGGGGCCAAAAGAGGATCCACGTACTCGTGCGGCGGAGCTTGGATTCCAGCTCCGTTTGCGTTCGCTTGGC
ATCCGCCCACTCGGTAGCCGCCTTGTCCCGCAGGAGTTCGGTGTCCGCCAACTTCGCTTGGATCTCGTCGCGCAGTTGAGTTATACGTACGAATTCTTCG
AGCGCGTAATCTCGCCCAGCAGACGCTTTCTCGAGTGACTCCTTGGTATCTTTCAGCTCCTCAGAGAGACGGGTCAGAGCTACATCCGGCGACGGGGGAG
GTGGATTCGGCGCGGGGGACCCTCCACGCGCCGACCCTAATGCGGATCCGCCATGGGTGAATCCCACATAGTCGTTAGTTACCACCTCTTCTTGGGTCAG
GCGCAACTCGTGACGGAGTCGATCCAAGCTCTCGTCCGCGGCTGCACTAGCGGTCTGGGAATCCTCCAGATCCCGCTCGATGTCGTGGATCCGGGATTGG
AGCTGGTGGATCTCAGATCCGGCGAGCGCCATCTCCCTAAGGAGGTGGTCGTTGTCATCTCGCATACCATCTCGCTGACGGGAGGCGCGATCCAGCCGTC
CGGTCAGGTCGCGGATATCGACCGCTTGATCGGCCAACAAGAGTCGTAGGTCCTGCGAACGAGAGGTCGCACGGTGCTCCCACCCCTGGATCTCCATAGC
CTGGTCATGGACCTGGGCTCGCAAGGTTTGGAGCTGGGTGGCGTGCAAAGACGCAGCTTGGTCGCTAACATTTTGGGCCGGCTGGAGCTCCGCCGTCAAG
GTTTGCACCCGATCGGAAGAGCTTG