Description :
From Genome Similarity Track
Location :
Scaffold_25:1300649- 1305746
Sequence
5097 bases(100 bases per row)
TGCAAGTGGTTATGAGCCCAAATATTACAACTGGGTAGTTCGTCAAGATAATGAGTACCAAGGACAAGAAGGAGCCAAGAGAGGAGAAACAGCTCAAGCA
CCTGCCGTTCGATGGGAACGACTTTGAGGTCTGGCTGGAGAGGATCACGTTGAAGCTGGAGAGGAAGGAGCTGTGGCGTTACTGCGAGACAGAGGTGCTA
GAGCCCGATGAGAGTAAGGAGTCTGAAAAGCATGCCAGGTGGAAGAAGGAGACTCGCCGGGCCAAGGAGATCCTGTACGATGGCATGACAAATCAAATTA
TGAAAACAGTGAAGTACGAGCCCACCCCCTTTCGTGTTTTGGAGCGTTTAAAGAAGCGGTTTGTCGGAAAAACGTACTTCAAGTACGCAGAGGAAATGAC
TAATCTACGCCGCCTACGTCTTGATCCAAAAGCCAATATGGCTGATCACTTAGGGGAGGTACGCCGGCTAATGGAGCATATTGCCGTACTCGGAAAACCA
TTGGATGACTATGAAAAACCGGCATTACTTATTGGATCACTACCGTCTGAGTATGATAACGTGGTAGAAACGTTTCTGACTAGCCATACACCGCAAGACA
TTAATGAACCCCCAAATTATGAGCAGTTGGAGCATGCTCTCGAGGTCGCATATGATCGCCGTCAAGGTCGTAAAACGGAGAGTGGCAAAGTAGATGACGA
AGATAAGGCTTATATGTCTAGTGGAGGTCGTGGTCGGGGGCGAGGCCGCGGACGTGGTCGTGGACGTAGTGGACCAGGAGGTCGCGGTAGCCCTGGACGA
CGTGGTGGTTTTGGTGGACGTGGCTCAGGCGGTCGTGGTGGAAGTGCTGGAAGAGGACGTGGACGAGGAGGACAAGGCAGAGGTACCCAGCAGCAACTCC
TAGGAAGCTGCTATCACTGCAACGAGCAAGGCCACCAAGTTCGAGATTGTCCATACTTGGGCAAGCGGCCACCAAGCGAGCGTTCTGGAGTGAAACAGCC
TGGAAAGCGCAGCAAAGCTGGTGGTGGCCAACAAGCTAAGAGTGGCAATGCGAAAAGCAGTAGCTCTCAGGGTAATTATTTTGGTGAAGAAAGTGATAAT
GCTTATGTTGCTGGTGATTGCCTTCAACGGAGAATGGAAAACATAGCTCATAAAAGATGGTATTTGGATTCTGGCTGCACAAATCACATCACGAACCAGA
AGAGCGACTTCATTACGCTCATACCGTTGAGTGCACGAGTGAGAGTCGGCGGTGAGAATTGGCTTAATGTGGCTGGCATTGGAACTGTCCAAAAGGTGTT
GAGAGCATCACGTGGCCTATGTACCCTTCTGTTACATGACACACGCTATGTCCCAGAGCTCCAGTGTAGCCTGTTCTCAGTACGACGACAGACTCGGAAG
ACGCTACCTCCCAATCAACGTGTTCGTGTTCATTTTGACGACGACGACTGTGCTATAGTAAAGGTGCAGAGTGCGTCAGCTGCAGCACGTATTGACGAAA
CCAATCTCTATCATCTTGAGCTGGAGAGTCCGCCTGACGTTGTAATGGTGGTATCGTCTACATCAGAGCAGAGTGCGAGCCTGTGGCATGTGAGACTTGG
TCACCCAGGACGAAATGTGTTCAACGCGCTGTTCCGACACGTAGATTGGCCTTTAGCTAATGTGGACTTGCGTGTTGATGAAACGTTTCACTGTGAGTCA
TGTGTGAAAGGAAAACTAACGCGAAAAAGCTTTCACACCGTTAACATTCCGGATCGTGAGTGGTTAGTTGGTGAATTTGTGCACATTGACGTATGGGGAC
CGTATGCCATCGCATCCTATTCGGGTAAGCGATATTTCGCCCTCTTTGTTGACGAAGCAAGTCGATTTTCGACTCTATTTTTGCTGGAAAATCGCTCTGA
GGTCTATGCCAAGTTTGAGTTGCTCTATGAGTATGTGAAGACTCAGCTCAAAGTGCGTATGAAGAAATTACGGTGTGATAACGCACGCGAATTGACTTCA
CTTTGCAGAATGTGTGAAAAGAAGCAGAGAATGGAGTGTTCGCTTACTGTGAAGCATACACCCGAGCAAAATGGCATAGCGGAGCGGATGATAAAGGACT
GTAACTGAACCGAATGCGATGTTTGCTGGCACATTTTCAGCTACCTCAGGATTTGTGGGCAGAGGCAGCCGTGACGACGGCATAATACGTTAATATTGTA
CCAAATGCCACCAAAGGTATGCAGGTGCCGTTTGCCGTGTGGCATCGAGAGACACCAGCGTACTCGCAGCTGAGAACGTTCGGGTGTGCTGTTCTGGCTT
ATGTCGACAAAGTTGAGAGGAAAAAGATGGACCCTAAAGCTCGTGCATCGATTTTCGTTGGCTACAGTCGAGAACAGCGTGCTGGATAGCAAGACAAACC
AAGCATTTTACAGTCATACGGCTGTCTTCTATGAGAGCAAGCCTGGACGCGTGTTTACTTGACAAATTCATCCAGAATCGTCCACAACAGAGTACTTAGG
TGTTGATGATGGTGTTATGGAGAACATCCCATCAATATTAGAAGCAGCTCATAATGACAGACTTGGTGGGGCCGAAGATGAAGAGCATCAGCACTTGGGT
GATGTAGAGCCACACTGCAGGGATGATCATGCAAGTAGGACCGATGGACATAATGCACATGTCAGTGACTCCCGAGCAGGTGGGGCCCGAGCTGATGAAC
GCTCAGGTGGCGAGGTGCATGACGAGATGCAAAGAAGCATAAAGCGTGGTCGATCATGTGTTGATGTCCCGCACAATGAATCTCGTCGAAAGAAACAGCG
GACCTGTAAGCAAATGAATCAAAGTGCTTCAAGCACAACGGTAGCGTCCGGCGCTAGAGACCGTGAACATTTGCAAGTTGACCACCTGCGAGGTATGTCC
AATGAGCATGGCACAATGCCAACTCATCGCTCAAAGAAGAAAATGCACAGTGGGCGGCGCAAGGCACCGACTGTAGAGGTCCAACACCAGGAATATGTTG
ACGAGAAAAGTAACACAATGCTTAATGATGAGTTGCCAACCCGTGAGTGGGCTTATACTCCGACGTCACGTGGAATGACGACCACAGACTCGGAGATGTC
ACGTTCTCGTGAGAACTCGTCAAAGGAGGGTGTAACAACCTCAAAGAAGCGAGGATTGCGAGAGTTTGTGGCTTTGGAAGGTGCAAACACAGAGGTCTGC
CCGGTAACACGGAGCGGACGTGTTAGCAAACCACCGTCATGGATTAGCGACTACGTCTACATTGCCTACTCGAACACAAATCCAGACGATGATGCAGTGT
GCTCTGGGTCTGTTGAATGGGTCAAAGCTCGAGAAGAGCTTCAACAGGCAATGGCAAAGGAGAAGGCGTTGGCGTGGTGGCAGGATTACTGCTGTCTCGC
TGTAAGAATAATTACTGAGCCGCATACACTGGACGATGCTCTACTGAGCGAGTATGCCGTGCAATGGAAAGATGCTGCGGATGAAGAGTATCGAGCCTTG
ATGGAGAACTGCACATGGGTGTTAGTACCTCGAGAAAAGCACATGAAGGTGCTAAAGAATCGATGGTTATTTCGTGTAAAGTATACTTCAGAAGGTGATA
TTGAGCGTTTCAAGGCTAGGCTCGTTGTCAAGGGATTTATGCAGATATACGGCATTGACTACTTAGAAGTATACTCACCGGTGGTTCGGCTAGATACTTT
GCGTGCGCTGTTGACTCTTGCCGCAGTATGGGATTACGAGGCACATCAGATGGATGTGACAACTGCGTTCCTCAATGGAGCCATTGACGTGGAGGTTTTT
ATGGAGCAACCCACAGGTTATGTCGCTGAAGGGAAGGAAGACTGGGTTTGCTTCCTGAAAAAGAGTCTCTATGGCTTAAAGCAGGCACCACGAGTGTGGT
TTCGCCTGTTGAGATCTTACTTAGAGGAACAAGGATTTGGCCTTTTGAGTAGAGCCTTGTGTTGCTGTGAAAGTCGTCGATGGATGGCTGGTCTTCATAA
CAATTTACGTTGATGACCTGATTCTTTTCGCACCAAATCTGGTAATGATTCAGATGCTAAAAGATATGCTCGATGCCCGGTTCAAAATGAAGGATCTTGG
AGAGTTGCATTACATCCTGGGCTGGGAGATTATCCGTAATCGACAGGATCGTACCGTGTTTGTGAGTCAGCGTAAGTACATGTTGACTGTGCTGGAGCGC
TTTCAGATGAGCGAGTGCAATGGGTGTAAAACTCCTAGTACTGCAGATCTGAAGCTCTCTAAGACAATGTGTCCCACCGACACTGATGAAAACGATCTTA
TGAAGACAAAACCATATCGTGCCGTAATTGGAAGCCTAATGTATCTAATGCTAGGCACACGTCCGGATCTGGCGTATTTGGTTCGTGAGTGTAGCCAGTT
TCTTGACAATCCTGGCCTGATGCACTGGAGAGCGGCAAAGAGTGGACTACGCTATTTGAAAGAGACGATTGACTGGGGCTTGCGACTGGGGTGGTATTAA
GTGGGCAAGTGAAAGACTTGACAACCATCTAGATGCATACGCTGATGCTGACTTCGCCAATCGTGTTGACGATTGCAAGTCTGTAGCAGGCTACATAACG
AAGTTTTGCGGTAGTACAATATCATGGGTCAGCCAAACTGAAAAGACAGTCGCACTTCATACCACTGAAGCAGAGTATATGGCATTGAGCCTATTGGTGC
AAGAAGTGGTTCACCTTCGACAAATGCTCAAGGAACTGAAAGTGCAGCAGCGCAATCCCTCTCAAATATATGTTGACAACGAGAGTGCCAAGAAGCTGGC
AAAGAACCCCCAGTTTCACAGCAGATCGAAACATATCGACGTTCGTCATCATTTCGTTCGTGAACGCATCGAGCTCAAGCAGATTGACGTAGAGCGTGTG
GCCAGCACCGATAAATATTGCAGATGCCTTCACAAAACCGCTTACTCGACCCAGCGTTCGAGAAGCACAGAGCAGCGATGGGATTGATGACACGCAAAGA
ATTTGAAGAAAGAGCGCCTAACAATGTCAACCAGTAGGTGGGGCTGTTGCGATGTACTGGTTCACAAGTTGAGGCTCTCTAGGGAGGTTAGCTTTTG