Description :
From Genome Similarity Track
Location :
Scaffold_195:13004- 16340
Sequence
3336 bases(100 bases per row)
CGAGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTAGGCGATTATACACTTGATCTGATCGCACCTCCGAAGTTGACTTCGGAGATCACTCAATTG
CGAACGATAGAACCGAAACGATTCTTGCGAGATCTGCGTAATGGCAAGATCAAGCAGATCTGAGTACTCGTCACGAAGGACGATTACATGACTGACATTC
GGTCGGCAGTGGTATTTGCCGAGAACGAACGAGTTCTCAGCAGCTCATCAATGGCCGAAAGTGTCCTCGATGAGAAGACTGGGATTGAGAGATAAACGTC
TCAATCTTGGGAGTCGCTTCAGGAAAATCCTTTATATAAGGATTTGATCGAATTCAAGAACTTGTTACCTAAATCCGTACCATGCGAATTGCCTAAGGAT
AAAGGCACTCGACATGAAATTGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTGGCCATTGCCTCGTGAAAAAGTACTTGCGATCGACAAAT
TCTTTGCAGATCGCTTAACTGCGGGTTATGTGAGGGAGTCAACTTCCCCTCAAAGCTCTCCGGCCTTCTGTGTGTGTAAGGCCACAGGAGGATGGCGGAT
AGTGCACGCATTCAACAAGTTGAATACTGCAACGGTACCGGATCAGACGCCGATACCGAGGAAGGACGTAATCATTGATACTATGTCAAAGAGTACCATC
TTTTCGTCCATGGATCAGATGGATGGCTTCAGTCAGATCCTACTGCGTGAATGGGAGATCCCGTACACGGCAGTAAGCACCCCGATCTTCATGCTTTGGG
AGTGGATAGTAATGCCACAAGGGCTTAGTAACGCCCCTGACACCTTCAACAGATGTGTTACGAATCTGTTGATACCGGTGCGAGACTTCGCACCGAGTTG
CTTTGAAGATGTATTCGTCCATAGCCGGGCTATGGGCCGAAATACGGATACAGAGGTTCATAGAACTCACGTTCATCAGGTTCTTACACTTATTCGCAAG
CATAAGTTACGCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATATCACTTCATGGTGTATCGTGTGTCAACACGGCGTACGCCCTGATCCTGAAA
AGATCAAGGCGATTACCGACTGGACTGTGCCAGCCGACGTTAAGAGACTACGAAAGTTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCGAGCAACTA
CGCTGAAATGACCGTTCATCTCTCTCGTCTTTTGAAAAAGAACGAGAAATGGTCATGGAACGCTGATTGTCAGCGTTCCTTTGAAGGTATCAAGTAGAGC
TTGATGCAATAGCCTATCTTGGAGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGTGACGCCAGCGACTTCGCAATCGGCTGTGCGTTAATGCAGT
ACGATGCAGACGGCGCAGAGCGTGTCGTCGATTATTAATCGCGTCAGCTGCAAGCAACTGAGCATAATTATTCAGTGCATGACAAGGAACGTCTTGCCAT
GAAGTATGCACTAGCAAAGTTTCGCGTCTATCTCCCCGGAGATAAGCCATTTGTAGTCTACAAGAACCATGCGTCATTACGCACTGCCGTAACAGCCCAC
ATCTCTTACAAAGGATGGCAAGGTGGCTGTCCTATTTTACGGAGTACAACTTCTCCGTGGAGTACAAACCCGGACGACTTAATGTCGTCGTGGACGCGTT
GTCGCGCCGACCCGATTTCGAGTCGGCTGCGCAGTCCAACAGTGGGGTTGATACCACTGTTGCAACACTAGTCGCTAGTGTTCCGTCGTCAACAAGCCTA
CGCAGATGATAAGGATCTTCTACGACTAATGAATCATCTGGTGACTCCATCTCGTAAATATCTCAAAGATTTGACGGCCTTGTATCGATCTTCTGCGGAT
CGATACACAACAAACAACGGGTTGCTGTATTATACAGCCGTTTCTGGTGACACACCTCGTGTCGTCGTCCCCACTCATAATGATTTGCTCTTACGCATCA
TGTATGAGTGCCACGATGCAACACCTAGTGGGTATAGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGACTTTTACTGGCCCCGCCAGTATCATTT
GTGCGCAAGTACATTCGTGCTTGTGAAGTGTGCCAACGGATGAAGCCGAGTCCTTCATCTCGTGCGACACTACAGCCTCTACCAGTCCCGGCAGATTGCT
GGCAGTCCGTTTCAATGGACTTCGTCTTTGGTTTCCCCGAAGTCGCTCAAAAGAATAACGGTATTCTTGTGTTCGTAGACCGATTTAGCAAGATGGTACA
TCTTGCTGCAGTTTATGAGTCAATCTCAGCCCAAGGTTGTGTCTTTGTCTTCATCGACATGGTATTCCGACCCCACGGTCTACCCCGTGAACTAGTCTCT
GATAGAGATCCTCGGTTCACGGCGACATTTTGGTAATCCGTGTTCCGATCCCTCGGAACACGTCTGCCTATGTCTACTTCTGACCATTCCGAGACTGATG
GTCAGACTGACCGCGTCAACCGCGTCCACGAAGAAATACTTCAAGGATACGTATAATCTTTCACAGACTGGAGCGAATTTTCGCCCATGGTGGAGTTTGC
AATCAACAACTCCGTGCATGCATCGACAACGCATACACCATTTTTCGTGAATAGCTTACGCCATCCACACCTACCCACCCATTTCGAGTGTGACACTAAT
TCAAGGGGGGAGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATTGCGTGTCGAGGTAATCGACGACGCGAACGTTGCCGATGTCAATGAAAT
CGACATAGAAGCTGATGATATCAGCAATAGTGAAGACACTATTGATGATCCAGATGAGGATGACGAGGCTGGTATATTAGCATCGCCAATGACTACACCA
GAGAGGATGAGAACACCCTCGCTGAAAAGGAGGATGACCGCCTAGCAGTGCGCACAAGGCGCACTGCAACAAACCAAAGTGATGCAGCACAAGATTTCCT
GCTGGCACGAGAAGTAGTGGCCTGCTTCGTGCAAGACTCCATCGCTAACACGGTGGAACGATAGACACGGAACGCTGACAAACATGGAAGAACAAACGTT
CTTCTATTTAATGTTGGAGACTTAGTTCTACTGTCTACAGTAAATCTACCTGAGCACGTAGTAACTAACGTAGGTAGTAGTAAACTACTACCCAAGTACA
TCGGCCCGTTCCGTGTACTACATCGCAAAGGCAGTGCGTACACGATCGAGTTGCCTCGCAGGATGCGTACACATCTTACGTTTTATGTCGGGCGTCTCCG
CCCGTACCATCACCACGAGGTCTCTTCATCGAGAGA