Description :
From Genome Similarity Track
Location :
Scaffold_164:13000- 14152
Sequence
1152 bases(100 bases per row)
ATTTCGTGGAAATTAGCTTCCCTCAATTCGTACAGGACTGAGGTGTATATGGCAAAAAATCTTTAATGAACCGGCTGTAGCATTTCAGGCTCCCTAAGAA
GGACTGCATCGACCGCAATGAAAGGGAAAGGGAATATTGATTAAGGACCCTAAATCCTTCGGGTCGGTCGGCTTCTATTCCTGATATTGACACTTGGTTC
CTGAGATACTGGACCTTGCGTCGTCCCCAAACACTCTCAGGTATGGTGATCGACAAATTCCACTGATCACATAATTCCAACACTCTGTTCACCTTTTGAT
AGAGGGACGTCCAGGATGACGCCAGGATCAGAATGTAATGACTATACGACCTCCGTCTTTAAACAGAAGGCCTTCGGTGCGGGTTTGCATCGCCGTCTGT
AAACACATCGACCGGTCGAGACACCTCATGATCACTTGACCTCTGCCGATCACCGATCGTGATATACCCATATAATTCGTTATCCACCATACGTTGATAT
ATCTGCGGAGCGTTTTTCAACCCGAACGGCATGCGTAACCATTCATATAGACCCTAAGGCATAATTAAAGCGGAGATCTTTCGTGCTCTTTCTGTCATCT
CCACAACTCAGAATCCCTGGTCATTTCCAGTGAACAGTAGTATAGCGCATTTTCCAGATCTTGCAAAAAATCGTTGATTATGGACATGGGATATACCACA
AGCCTCGTCAATTCATTAACTGTTAGGTGGTCAATACACAGTCGTATATCCACCCCATTCTTTTCCACGACCACGACGATTGGTGACGCCCATGGTAAAG
TAGAGGGACAAATTATTTTGGTCGCTAGTAACATTTTGATCAGGTCCGCCAACTTTTTGCGGGAATATGGGGCGACTGGACTTACTCGTTGTGCTATTGG
AGTTGCTCATTCAACATCTATGTCACAGATGATGCCTAGTGCGGTGAGTGGTAGGGCATTTAATTAACCCATCAGGAAGTGTCGTTTCTTCCAGATCAGA
CGACGTAATTCTTCTTGCTTCTTGGTTAATGGGACTCCCGGGTCGCCCATCGGTATGTCGTCAATTTTTACCTCATCTGGCCTCACATCCAATTCCGGTA
AGACTGCCATATGTTGTCCAATATCCTCTGCAAACAACACTCCACCCTCATG