Description :
From Genome Similarity Track
Location :
Scaffold_1196:1300- 3610
Sequence
2310 bases(100 bases per row)
CCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATATGTTACGATTTGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTGCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTAACCTCATGTCGGT
GATCTTCTCGACTTCGAACTCGTCGGCCTCGAGATCCACATTTCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCTACCCGGTCGGATCCATCCACC
GAAAGACGGGTTTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGGAACAAGCGATATTCGGTACCTTCCCTTTTAGCTTTACCGC
ATGTTCTCCTATCTTTTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCCTTCACCCGATCTAAATAAAGCCACACC
TGCGATCCCACTTGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACCTGGGATCTGG
CTTGCCGGTAGTTTTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTT
GGGATCCCACCCATGTACCAAGTAAAATGGGGTGTCACCCCGGATCCTGTCTTGGGCGGTCATCGGGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCC
CTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGATG
CCCGCTGTCTCTGCCCCAGGATCCGGCTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGACTCCCGATCATGTCTAATCATCTCACTAGCTCCAAATCT
TCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGCGCAGCTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAGTCCACCCAAATC
AACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACC
CCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTC
CCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACC
AGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCATTGCGTAATCCGTAGCAATAA
TACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTCGTCCCAAGATCCACGCTTCTTCGTCCTGTGCTTTGAT
GATCCGCTCAATGCGGACTCCATTCACAAATGTTTCATCGAGAATCTGGGGACTGGATCCAATCCTTCCTCTAGATCTAGTGACAGTCATTACCTGGACT
GTCCTTTTCACGGATCCAGCCACCACCACTTCGTCTAACTGGTTTAACGTGACGAGATCCTGACGCTCGGCCTCTCTCTCCACCTCAACGCCACATTGAT
TTCGTAAAGCGGCACCTGCCAAGCTGTCCGCAGTGGCATTCCAATCTCGCTCGACATGTACCAGCTCGTGATTCATCCAACCACGTAGGTGTATCATCAC
CTTCTGTCGTAACAGTGTTAGGACGGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTC
GGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGTTATACTCTGCTTCATTGATGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCTTACCA
CTTCCCATCCGGGCAATTCCCACAGTATGGCGCAGTATGCACCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAGCTCAGGACGTACAGATCTTCATC
CACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGTTCTTTCTTAGGAGCGATTCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATG
CTCGCGGCCA