Description :
From Genome Similarity Track
Location :
Scaffold_3082:1300- 2909
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3082-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1609 bases(100 bases per row)
GATGCGCATGGGGATGTACTTCAGCTCGTGGCCCTTGTACTCGGCCGACTCGTCCTCCTCGTTGTCGTGGGTCTTTTCGATGTCGGCCATCGAGACGACC
GAGCCCTTGGAGTTGCGGATCTTGATCTCGTCGGCCGGGGTGTCGGCCGCGTCGTAGTTAATCGCCTCAATGTCATCCTCCGCGTGCCTGTGCATGCCAA
GGAACATACGCTCCATGAGGTACAGCGCCGGGTGCAAGATGACCGAGAACGCAATCGTGATGTGGAGCTGCATGAACAAGAAGGCGAGCACGACAAGGCC
ACGGTCCGAGGCAAAGCCGAGCTTGGAGAGGCCGGTGGTGGCGTCCGGGTAGATCGTGAAGAGCAAGTTGCCCGAGATCTGGCAGCCGATCGCCGAGTAA
CCGCTGCTCGCGAGCGCGATGAAGAGGCACGAAATGAACGTCATGGTGATGCCCACGACGCGCGGCATGCGCTCCGGTTCGCTGTGCTGGCGCTGGANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTTACCGAACGTGGTC
GCGACCTGCTTGAACGAGATGGACGGCGTAGGCACCGACGGGTGGCCCGACATGCCGTGGAGAAGCACACCGACGCCGATGATATCGGCAATGAGCGTGC
CCATGCAGCCGGCGAACGCCGCGCCGGCTCCTTCCTTAAGCGTCGGGATGAGCACGACCGGCAGCACGAGCAGCGCCATGAGGATGATCCACGTCGTGTC
CTTGAACGTGCCCGGGAAGAGGTCCGGGAGAAGTGTACCACCGAGCACGAGGAACACGCAGGGCACGAGAAGACACACGCCCATCTGGGACACGACCACG
AGCCAGCGGCCCGTCTTGCCCATGCACCACTCGCCGAGATCACCGAACGTGCGCACCGACTTGGGCGCGACGAGCATGACACGGCAGCACACGACGGACG
CGTAGACGTTGGCAAACGCCATGAAGAGCATGGCAATGATCGCGAGCACGGGGCCGGCACGCGAAAAGTTGGCGGGCATACCAAGGGTACCAACGCCGTA
GACGCAACAGAAGAGGTTGAACGCCGCCTTGGCGTCCTCGAGCGTGAAGAAGCTCCTGCTCTTGCCCATGGTAGAAGTAGTCGCTAGATGGGTCGGCTTG
GTCGAGGCGAGGCAAATTGGCGAGTGAGCTGAATGAGGAGACCGACGGCAACCGAGGCGAGGCGAGTTGCGTCGGTAGGTGGGACCACCGTGAGGCGGCC
CCCCAGAAGGGGGGAGAGGGCCTGAGGCCGGGCCCCCCCGGCGGCACCTACACCTCAGATTACGCGCCGGTTTTGCAACCGATGTCGGGTGGATAGTGCA
GGAAGGTTACCGTCTTGGGCTCCAAGAGGACCAGAGGGAACCCCGTTCTCGTCCTTTCCTCGTGTCTCTGTTCTGTGCCGGGTGCTGATTTTCGCTGATC
TTGAGCGTGTCCACTGTAGCGACGGATCTGTTCTCAAGCAAAGGCCAAAAAGAGCCGGAGCCATCTCACGTGGGCAGAGGTGCCTTTCGGAAAGTGATGG
GATGCGAGG