Description :
From Genome Similarity Track
Location :
Scaffold_369:130- 4617
Transcript NameFunction/comments
g16207.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g16208.t1hypothetical protein

Sequence
4487 bases(100 bases per row)
TTACAAAGATAAACACTCGAAACTTTGCGAGTTGCCAATACTTCCCAATGGCAAGGAGTTCCTTGTCATGTACGGGTAATTGCGCTCAGCTGCTTCAGCG
TGACGCGATTGGTAGTAAAACCGACACGAATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATTATACACACGAATCGCGAAATCGGATGCATCGCA
CACAACGTGGAATGGGCGATCTGTCGGCCAACGCCGAAGATTGGCGCTCGAAGTCAAGCCCTGCTTGACTGGCTTCGCTAAAGCTCTGCTGACATCAGCA
GTCATTCCCGAGATTTTGCAGGCCTCATTCTTCAAGATGCGACAGCGGGCGAATCTTGCCCGCGTAGGTGCTCACGTACTTGCACATAGTTCGGTGGCGA
GCCAAGAACTCCACAGGTATCCTGTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCAAC
GAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTTGCGTAGAGGTTGTACTTTCGCATGAGCTCAAGCAACTTGCGGAGA
TGCTCTGTATGCATCTCTACATCCGATCTCCCATTCACAGCCCGGCTGTGAATGAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCAACAAGTGCG
TGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGG
GATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATTTTTT
CGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCTGCCCTGTGTCTTCTTGACACAGAACGTAG
GCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCTTGCCTTGCGACGATTTTCAAATAAGTCGTTGATCGCCTTGACTTGCTCACGCGGCAATGGCCA
CTGTCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACA
TCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGT
CCGTGCCCTCAGAGATGAGCTGGTCCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCGTCGTGCAG
GTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCA
ATATTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACATTGCTTGTAGCGTCTCGGTCCCTGACCGAG
ACTTGTGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTT
GTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCATCGCATCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGC
ATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGTAGCGTCGGCTCCCAGAGCCGACACGCCTTCTTTACCTCTACGCCTAACAGCGGAGTGTC
TTTTGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTTGCTTCGAGACCCCCTTGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACG
TTTCTTTCCAACGACTCTCGCTGTAGCGGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACATGCACTATTGGATACATTCAGGTTGACCACTCC
ACAGGGTGGTCCACATTCATAGCAAACGCATATGACTGGTAGAAAGCAACATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCATCCAT
CCAATGGCAGAACCTTTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTTACACCAAAGCTATCGTTCGGTTCC
TTTGTCTTAGTTTAAATATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACACCAACGCTTCCTCATACACGTGCGCACACGTGTAAGCTAAAG
TAGTGGGTCTAAGCAGACCCATTACACTCGCAGTCGTTGTTGTCCGCGCGGGGTGATCGGAGACAGTCGCATCCCGCGCTGGTTCTGGTGGAGGGCCGCA
TGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCTGAAGTGCTCGATCGTGCGCTTCGTCCAGTCGATC
ACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCAACGAACTCCTTCTCTTGAT
ATGAGAAGCGTACGCATACGATACGCTTCTCGGTTCTAACAACGACACCTGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACTTCATCGAA
GTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGGCGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCCTTCTTCGAGCTTACCTTCAGG
ATGACAAGGTTCGTCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTATCGCTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGA
CCGCATCACCAGCAGGCGCGGGGCGCCCTGCTGGTCCCTCTAGTTTTTTTATTGCCCGTGATGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGC
ACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGTTCCCAGCAGCGGTCG
CACTCGAGAGGTTCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCT
AAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATG
AACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCATGTCATGCTTGCTCT
GTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCA
CGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTTGACAACGGGTCGACCTCGACA
AGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTC
GAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTC
CCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCCTTGTAGACGTGTTTCGGCTA
CCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTGAGTCGGTCGTTGGACGGACTACAAAGTGCT
ACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTTGGTGTATTTAACTTAAGTTCAGTATACT
TGTATCCGCAAGTATATTTAAACTAAGACAAAGGAACCGAACGATAGCTTTGGTGTAAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAA
CTGATATTTCTAATGAAAGGTTCTGCCATTGGATGGATGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGATGTTGCTTTCTACCAGTCA
TATGCGTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCAACCTGAATGTATCCAATAGTGCATGTTGCACTAAGGTAGGAGGTG