Description :
From Genome Similarity Track
Location :
Scaffold_2187:130- 3069
Sequence
2939 bases(100 bases per row)
CACTTCGTCTAGTCGATTCAACGTAATGAGATCCTGATGCTCGACCTCTCTCTCCACTTCAACACCACATTGATTTCCGTAAAGCGGCACTGACCAAGCT
ATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCC
GGGGCCTTTCAGTCAATCTCACCTCGCACTTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAGATCCA
AACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAG
TATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGCACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATC
TGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCT
CGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAG
CCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTC
TCCACCGCTCCGTAGTTCACTTCATTTGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGA
CTGCCCAGTCGCTGGCATAAACTATAACCGTAGGTTGGCGTTCTGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGCTCCACGAA
GGCGTGTTGAGCTCGGATCCACCGAGGTTCCACCTTTTCCGAGTTCTGATCCGTCGTCTCTATCTTGATTGGATCCTCTTTCCTTTGGTCCCGGAGCGGA
TCCAGCTCCTGGTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGACATCTCCAGGGTCAGAGCTTGTTGGATTTTGATCCGGA
CAGCTGGAGTGGTCATCGCAGCAAAATCTAATTCTCTCAATTCATATAGTACCGCATCAAACAGTGCGTAATCCTCTGCCCAAGAAGGATTGCATCGCCC
GTAACGACTGTGGGAAGGACAAGTCTGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCTAACTT
TGCGCATCCCTCAATAGCTCTTCACCACGCTGATAGAGAGGTTGGACTTAGTACAAGCCTCCAGTAGGGATGTCACTCTTTCACACAACTGATCACACGT
ATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCTTCCTAACACAGACGGGGTCCCAGGATCCCCTAGCTCCCCCGCTTCGAATGGATCCACTTC
CGTATTGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTCAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTC
TTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAAC
CACTGGCCATGTCTAGATAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATCAGAGGCATCGAATACACCATCAATCGAGTCAGGCT
GCTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATG
ATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGA
CATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTATCTTTACCAATCAGCAGATGTCGGCCCTCCCAGATTTTCTGACGCAGACGATC
CACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCT
CCCAGATCCTCGGCGTGTAGATTCCCTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGT
GTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGAAAAGCTTGGATTCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCA
ATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTAGATCTCAACCCGTCGATC
CCTCTGCAGGATCTTTCGCGAAGTTGGATATGTAGGCCGATCCACCAAGGGGCCCGTTGGCTCCGCCGGGAGCTCCCCCGCCCCGAGAGATTCGATCTCG
GTAGTCGCCTCGTACACCAGATTCTGCCACTCTTGTAACGACGGATTCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCG
CCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCAGGAGGTATTGTGATCGACCTGGTCCTTGGATTACTGTAGGCACC
CACTTTTCGCCCAGTGTGACCCACCGTTTCTCATGTTCC