Description :
From Genome Similarity Track
Location :
Scaffold_185:13- 8521
Sequence
8508 bases(100 bases per row)
CCGGGGGGGTCCAGTACCAAGAGCAGGGGATGCACTACGCGGTTGTTTCGCGGCCGACGGACCCGCCCCACTTGGAGACTGCGGAGCAGCTGAGATGCTA
GCGGCAGGAGGCGATCCAGCCAGGGGAGAAAGTGGATCCGACGATCCAGGGGAAGGAGAAAGGGGATCTGAGATAGCAGCGGCCACCAAAATCAGTCGTC
GACGCGCCAAGTTCCGCTCTGATAACCTGCGATCACGCTCTAGAACTAGCTGTTGGTGCTGAGCACGAGCAGTAGCGAGCGGATCCCGTAGCTTCGTTGA
AGCTGCCTCGACATATTTCATTTTGTCACCTGGATCAACATGACGAGTGAATATGGGATTACAAAAGAGAAACAAAAAAGGATCCACGTACTCATGCGAC
GGATCTGGCATTCCAGCTCCGTTTGCGTTCGCTTGGCATCTGCCCACTCGGTGGCCGCCTTGTCACCTGTAGCTCGGTATCCGCCAGCTTGGCCTGAATC
CCGTCGCGGGCTTGGGTCATGCGTACAAATTCCTCAAGCGCGTAGTCTTGCCCAGCCGATGCTTTCTCGAGCGACTCTTTGGTATCTTTCAGCTCCATGG
AGAGAAGAGCAAGGGACAAATATGGCGACGAGGGAGATGGATTCGGTACGGGGGACCCTCCGCGCGCCGACCCTAATGCGGATCCGCCATGGGCGGGTCC
CACGTAATCGTCGGTCACCACCTCTTCTTGAGTCAGGCGCAACTCGTCGCGGAGCCGATCCAAGCTCTCGTCAGCAGCCGCGCTAGCAGCTTGGGAATCT
TCCAGATCCCGCTCGAGGTCGTGGATCCAGGATTGGCGCTGGTGGATCTCGGTTCCGGCGAGCGCCATCTCCCGAAGGAGATGGTCGTTGTCATCTCGCA
TGCCATCCCGTTGACGGGAGGCGCGATCCAGCCGTCCAGTCAGGTCACGGATCTCGACTGCTTGATCGACCAACAAGAGTCGCAGATCCTGCGAGCGAGA
GGCCGCGCGGCGTTCCCACCCTTGAACCTCCGTTGCCTGATCATGGACCTGGGCTTGCAAAGTTTGGAGTCGGGTGGCGTGCGAAGACGTGGATAATGAC
TGATAGGCCTGCTGAGCCGCCGCCTCTGCGCATTGAGCCTGGTCCCGAGCATCTTGGTCCGTCTGGAGCTCCGCCGTCAAGGTTCGCACCTGATCGGAAA
GAGCTTGGGCTAAAGCCCGCAAATCGGTGGGCAACATAGAGGGGATGACAGGCGGAGTGGTGGATGGGGCCTTGCCCAGCGATGTGCTAGTGCGCTTGGT
GGAAGACATGCGTCACGTAGAGGAGAAAACTGTTGGAGGAGCAGGGACGCTGGGAGTGTACACCGTGAGCGCTTTTGTGCAGCGCCGACCACGTACAGGA
GGCGATTGTGGTGAAGTTCTTTCTCAAAAATAAGAGAATGGACCTAGCAAGGGGTCACTATCCCGAATCAGTGACGTTGTCAAGTGATTAGAGAGGATTT
GGATCGCCAGGCTAGGGATTCACGTTGCCTGAGGTGGATTCTTCGTAGTCGGTACAAAATGAGATCGCTTTGTCAGTCGGTCGACGACGACCCAGATGGA
ATCTACTTTTCGTTTTGTTCGTGGCAAGTCAGTGATGAAGTCCATCGAAATCGATCTCCACCGTTCGTCGGGAACACGTAATGGCTCCAGCAGTCCCGGT
GGCTTCGTTAGCCTCGGTTTGTTCCGTCTACAAGGCTCATAGTCGGCAATGTACGATTGGATTGACTTCAACATCTTGGTCCAGTACCACCTCCTAGCCA
GTGTCAGGTACGTCCGCTCCGATCCCGGATGTCCCCCGTAGTTGGAGTCGTGACACTCACTGATGACCACCTGCCTCAACTTCACATCGTTGGGCACTAC
GATACGTGGACCATCGTCGGGTGGAGTCTGGTACCACATCAAACCGTTATCTTCCGAATAGCAGCGATATTGTTTCTTCTGTTGTCGCCTGGCTTTCGCC
TGCTGGCTATCTGCACGCCGCTGGATTGTTGTAAAAATCGCTTTTGCTTCTCGATCTCTCTTGTACGCCTTTTTGATATTGGCTATCAACTCGCTGTCCG
TGGCCACCTCGCTGACTGCTAAACTGAAGGACGCATCATTGAAGCTGGTCACACTCAAGTCATGAAAGTACTTCGTTCCGGTTGCAAGTCTGGTCTTCGG
CTAAGCGCGTCTGCGATTCCGTTCTTCGCACCTGGAAGGTATGAGAACGTTGGCTGATACTCCGCGAGGATATCGTACCAGCGCGCGAGACGACGGTTCG
CCATATTTTGAGTAAAGAGACCTTCAAGACTCTTGTGATCCGTTTCCACGATTGGTGGCTTGTCCAAGCAGTAAATACGGAAAGCTGCTAGCGCGTGAAC
AATTGCCAGAAGTTCTTGCTGCTGCGTCGGGTAATTGAGTTCCGCAGATTTCATCTTCCTACTGGTGTAAGCAATGGGTAGCTCAACACCATCGACAACC
TGGAACAGGACTCCCCCGACTGCAAACTTGCTAGCATCCGTACGCAAATACATAGGCTGATTGAAATCGGGCAGGTGCAACACTAGTGGATTGCACAGCC
GTTTCTTCAGCTCCTTGAAGTTCTTCGACTGCTCTTCGTCGAAACGAATATTCGCATTGCGCTTGGACTTCTTCTTGAGCATAGTAGACATACTTGCTGT
CAGCTTCGCGTTGTCTGGGCAGAATCGTTGGACGTATCCAGTTAAGCCGAGGAAGCTGTGAAGCTCCTCTTGCGTTCTTGGAATTGGCCAGTCCTTGATG
GTCTGCACCTTATCTGGATCCATCCGCACGCCGTTTCTCCCAGCAAAATCTCCAAGGCATGGAATCTCGTCGGCACAGAAGACGCACTTGGACAGCTTCA
CGTATAACTTGTTGCCTCGCAAGATGTCCAATGTTTTGCGGAGAGCATCCAAGTGATCTTCAATCTTCTGTGTCTTCGTGAAGATGTAGATGTCATCGTA
GAACGACTTCATGTTCTCCAGATCGCGAAAGAGCTTCGACGTCAATCGATGCATCGTCGCTGGCGCGTTGCAGACTCCCATTGGTAGTACCAGGTACTCC
CAGAGTCCGTTGGGCGCCTGACATGCTGTGAACTTGATATGTTTGGCACGCATACGAACTTGATAATACGCGGACATCAAGTCCATCGTTGAAAACCAGT
ACCCTCCGGCCATGGCGTCCAGTATGTCTTCTTTCCTTGTCATCGGTATGCTCTGCCGTATCGTATTAGAGTTCAAGTACCGATAATCGTGAACGATCCG
CCACCCAACTGGTTTCCGGATGCAGAAAATTGGCGCCGCGTGTGGGCTGATGCTTGGTCGGATAAGTTTCTTCTTCACCATGTCTATAAACCAGAGCACG
ATCTCACGTTGTAGCTCAGGCGACTGTCGCCACTGTTGCCGGTACAACGCAAGGTTGGGATCTTTCACGTCGATCCTGTGCTCGATTTCACGCTTCTCCG
GAAGACCTTCAGGGAGTTCAGGTCGAAACACCGTGTCTTTGTACTTCGTCAGCAAGTCAAAGGCAGGGTTTGCCTGGAAACTTTGCCAGTCTGTCTCCAG
ATAACGTTTAGCTTTTGCAGCTCCGACATTGTCGGGTTGGTCTCGCCGCTCCAAGGATCGAGCGACGTTTTTGATCATTTCGTTCGTCAGAACCAACATG
AAGTCTGGTTCTTCGATCGACTTGGTCTTGATTCTAAGGAACTTTCGCAGTTTCTTTCTCGTGATGAACTTGGTCTGTATACCAGCTTCATCTGTGATTC
CCATCGCGAACATCTTTTCCACGACGGAATCTCTTCCTCTGGTATCGCTGCTCCCAGCAGCAGTACCGTCGCGTCTCGACGACTTCCTCTCGTCTTCGTC
TGCTGAACCTTTGCCAGCTGACGCGTCTTCCAGTCGCTCGCAAGCAACTCGTGGGGTCTCACTCGGCTCTGAGTCGTGAACGGGATTGACCGCGGACTTC
ACACCCGTTTCCAGCGCGGCACCTCGACCGAAATCGGGTCTTTTCGCCGACAGGCCTTTCGCCCCGACAGATCTCCGAAGCCCGGAGGCAATCACCGGTC
CGCCTTCCTCGATTGGCCCACAGGTTTCACCTGCTCGTTCCCAGCGCAAAGTTTTCTCTATTGTTCTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTA
CAAATGTCGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGTACCGGGAC
AAACTGGACCTTGTAAACTACTTATATAGGCCAACTAGTAAAAATAAGAACACACTACTAGCACGAGCAAAGCTAGCAGGTGTTTAGAATCCTCGTGGTC
CCCACAGTGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGTAGGAAGAATAAAAGGGAGGCAATTCAAGCACTC
CCCGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAAACCTCCCGATAGTAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCG
CTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCAGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAA
ATTCTGTTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCAAATAAGAAGTCCTAATCAAGTATACAAATAGCAAGTGAACAATGATCCGTTATGGATC
TTCTTTCATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCTTGTCCCAGACGGTGAACGTGCCTTCCAAGGGTTGCTGAGTC
TTCCGCGAACTCATCCCGACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGG
ATTCAGTGACATGTGCCCGTATCCAATACTCGTTGAACGTTCGGAGGTGACGCCGTCGAGTCCCTGGCACCTTGGCGTCTCCGTACATCACCTGACCGAG
GGTTCGTCGCTTGAACATCTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGAGAAATCACTACACCACAACTGCCCCTGTCGCA
ATGGAAGCCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTCCAATTCACCATCTCGCCACCGTATGTCCAAGCGCCTGAATCGAGTCGTGTCCGA
CGCATTTCAGCGTCTCAATCCCCGTAGACGTCGCGAACGTGAACAGCTGGAGGTACGTCAGCTCATCCTTCTCTTGAATCATCGGTACCTTGCTCATCAC
CTCGCATTACTCGACTTGCTTCTCAGGAGGGCAAGGCCGAGGGTTCGAACGTTCCTCAGTCTGCTGCACTTCCTCCGACAGCAGCGTCATCAACCGACCC
TCCGGCGCCCGCTGCCCCGGACTCATCACTCCCTGTGGTAGCTTCTGCAGCACTCCCCGTCGTCGCTGAACCCGCGGAGATGGCTCCTGCTGCTCCTTCT
GCTCCAGCTGGTGGTCCGCCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCGGTCGATCACATGATGACCTCGATAA
TCCCGTACTTGACTGCAATGGCTCGTCACCAAGTGCAGATCAGCGTTGCGCCTCCTGTGGTGTAGGGATTTCCAGATTCGACCATACGCCAACCTACTTT
AGGTCAAGAATTGGCTCGGTCTGATAACCCAGATCTTAGGAGCAAAGGATCACGGTAAGTACTCGGCGATCTGTCCGGATATGCTATCCGGATAGCCGCT
GAGCTCAACGGTCGCCGGAACTCAGCTGAAGGGTCGGTAGAGATCCTAAACGACTACATTTCACTAGATATTTGTATGAGAAGCATAGGATTAAATAGGG
GGAGCCGAAAGGGCTCCCAGAAGATAACAGAGCAGAATTTTCCTAGTCCAAGACACGTGTACACTTTTCCGGTAAGTCCCTGCATAGGGCTGGATTATGC
CTGCCGTCAGTACTCGAGAGGCATAGCTTGTAGGGTATTGACTGGTAGCGCCAAGAGATTAGGTCGGTCCGGGTAGGACAAAGTCTCGCTACGCGCGAAA
GACAGTCCCGCATACTCAGCGGGCCGGTACGTCGGATAGCCCGGGTGCCGTAACACTTCTAGCTGAGCAGCCTTTGCGCTCGGTGACCTGTAAAAGCGCT
CGCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGTGAACGAGCTCAGCCGAACCAAACTCGGCGGAGCCTCGGAAGTGATCTGACTTGGTTAG
TCGGAGCCGAGTAGAAGCGAGCCACTCGTCTGTCCCGGAAGGGCCGGACCGCGAGGGGACCACCCTCTGCGCAGGCCATACAACCGCCGACCTAACTCGG
AGATTCGTTGTGGTTTGTGTAAGGAATCCACATCTGACGGTATTTGTGTGTTCTACTACACCACAACTGGTGCCGCGACCCGGGAACAGGAGTGTGTGCT
TCTTTTTATAGGTGCCAGCTAACCAAGTTAAGAGGAAGAGAAGAGAAAGAGAAGAGTGAAGATGGTCAAGGGATCAGCAACTCCGAGCGACGGAAGCCCA
GCGACGGCTGGAGGATCGCCTCTCGCGAGGTCGGACCCGGCGGATCAACGACTCATCGCCATGACGATGGAGGTGGGACGAACCGTCCAGTTCGACGAGG
ATGGCCAAGACCAGGAGAGCGAGAACGGAGATGCAAGTGAAGGAGAGTATGAAGAGAAGGCCGAGACCGCTGAGCTCGGAGAAACGAAGACTACCGCCGA
GCTACTTGGCGAGGTGGAAGAGTTGACGCTGCAGGTGGGACGCATGGGAGCCCCACGTCCTGTCGAGCGCAACTTATCCGCTGAGCTCGACGAAGGTGCG
GACGATGAAGAAGATGAAGAAGAACATGGCGTTGCGCAAGGGGACCGTCCGCCCCATATTCCGAAAGCGACGAGGAACGCCGATACGCCGAGCGCCAATA
AAGTGTTGGCTCGACTCGGCGAGGAGATGAGAACGAGATCGGAATGGATGATGATGTTCGCGCCGGTGGCGATGGCGCAGGCGAAGTGGCCGATGCTGGG
TCCCGAGCTAACTCAGCCGGTACGTGCAGCCAACATCAACCAGTTGGTGGAAGAAACTGTGTTGTTGCTGAAAGCGATGGGCTATCGGTGCAACAGCCGA
CCGACAGCCTCATCCTGTCCGACTGGAGTCTGACCCGTGGCGGAGCTGAGCTCTGGCAATGGAAGAAGAAGTTGAGAGTGGCGTTTGGATTGGAGAAGGC
CCCTGGTGGAACGAGGAAGGTATACAGCCGAGTAGCCGAGTTCAAACCACTCGGCGAAGACCCAAGCAAGATTCCTTTGCCGAAGACCCCGGAGACGAAG
AGACGTGAAGTGTTCCGCGCTACGCAAGGGACTCCGTACTTCGAAGACTCCCACATGCTGACTCCAATGAAGCTAAACCCGACTCAGCGAGCGCCGAGTC
GTGGGCAGCGGAATGTTGGTCGTTACCGTGAATTGTATGACGCTGCAGATGAGGCTGAGACTTACGAGGAGGATGAAGAAGACGACGACACCTTTGACGT
GAGGGGTAACCGTGAAGAAACCGTGAATGATTACATCCGAAACTTGAGCTTTGACGCGGCTGAAGAAGACTCGACGCAGTACCTAGAAGTCCGAACCCAC
GCCTCGCTCGACAAAATCGCCGAGCTCGAAGGAAAGCGCTACCGCTCTGATACGTCGCTCCAGTGGCTCAAGCGTTTCATGTACGAGATGAAGAGCACCA
GGATGCCCCAAAGTGCCTGGTGCGAACCTTTCTCGCTATGCTTGGGACGCGCGGCGAAGAGTTGGTACAGGCAGCTGCCGAAGAAGACTCAGCGACGTTG
GAAACTACTCAGCGAGGCGTTCCTGGACTATTATTGCTCACAGTTCGACCAATCCGCCCGCACTCGTTACTACTCGGCTAGACGTAAAGTCAACGAACCG
ATCTGCGACTTCCTGATCCGACTCAACGGGTATGCTCGGACAGCCAAGATCCAGTACGAGAAGGGTAGCGCCGACGCGGCTGACCATGTCGAACACTTTT
TGCTGCATTGTGGTGATGATGATGTGATGGATTTGATGTACCCCTTGCAGTTGGAAGACATCAGTAAGGTGGAGCAGATAATCAATCGTCGGATCCTCGG
TGAAAAGCGCAAGAAGCAACGCGACCTCCTCGTGATCGCACGAGGCAGAGACGATAAGCGGAAGGATCAGGGCCGCCGAGATGAACGCCGAGATGGACGT
CGAGATGAGAAGCGCAGTCGCAAGGAAGAAAACCGCGACCGCCGAGTCAAGTCGTAGACGCTGACTCTGACGGGGAGGAACTCATCGATCAGAACCCGCC
GAGTCCGT