Description :
From Genome Similarity Track
Location :
Scaffold_1524:13- 7755
Transcript NameFunction/comments
Phypl_g13616hypothetical protein

Sequence
7742 bases(100 bases per row)
GACAAgcggagtaccccctccgtaaGTTGGTAGTCCGGGCGACCGTTGGCAAGCTTGGATCGCGTCAGCAATTTTGCGATACCTGCTCCGCCAGAATGGT
GCGCGTGCCTGGATCTTCTTGTGACTCTTGATTTCGCCGTGAGTCCACCAAAGAAGATGTCGAGATCAAGGTTGAGCCAGGGACTGGTGCGTCGACGGAA
GGTGAAtcaccgtcgtcgctgctgaagatcgaAGGATACACTGATCATCAGAGCCCTGGGaggagctccgacgacgtAAAGGATGAATGTTCAGCGATGG
ACCTTGAGGAGAAGCCTCCATCTTCCCCCCAGGTCCCTTCGGGGACCCCCGCGGGTCGCGAGAACATTCGCGATTCGCACGATGGAGATCCATCGGTGAA
AACCGAGGGATCTTCATCTAACATCACTCATCTAGCCTCGCGCGCGACCTTGAAGAAGGTGACCCCGCGCATGAAGCTGAAGGCCCCGGAGTGCGACTCC
GAAGATCGCAGTGCGCTTGAGGACTGGACCGACGATCAGCTTGAAGCAGTCTTCTACCGAAAGGGACTGTACGCGGTGCTGGTCGAGGATCCAGTTCTGA
AGATCATGCGGCTGAAGCTGATCGGTGATCTTCGAGGACCCGGAACCGCTCCCAGGGAAGTGCTCAACAAGCTGGGATCGTACCAGAAGCGTTTGACGCG
AACGACCTGTTCGATCTGGAACTGGCCGCGATCACGAAGGCGACGTTCGCTctcttcgagaagctggctgTTCTGGTCGGACTGGTCACGCCGACTGCAA
CGATGTTAGCACCGCGCAGCGGTTCATCGCAGTACGCGTCGGCTACGTCGGATGCTGGATCAGACAGCTGGATCGAGGTGAAGAGGATGACGCTGGGACC
AGCTGGCGCCACCAGGCTGGAAGCTcggaagaaggaggcgaagtTGGCCTCACCGCCGGCCGCACCATTAACCTCCGCGACGCTAGCCACAGACCAGGAC
TCGCCAGATCGCATCCAGACGTTCTTCAACGCTGCGATGCCTCGATTCTTGAAGGAACAGTAAGGGGATACCGCGTGAGCAGCCACAGCCACCCAAGAAG
CCGAGGCAGATCGACGCGCCAGACGTTGAGATGATGTCGGTCGGATCGGATCATGACCTTCCTCCGGCGGGTGAATACGATCCGGATGGCTTGAGTATCG
GTAGACCTCGACGTGCTGTGGCGGCGACCGCAGAAGCAACGACCGGGGGCGCCACTTCGGCCGCACGAATCCGAGTGTCAGCGATCTCGGAACTTAAGGA
ATTCTCGGGGAtggacaacgacgaagatcgcgccagcagctggctCGGCAAAGTCAAGTCGGCGTTCATCCGTGATCAGGTTCCAGATAGCGAGAAGTGC
TTGGTCTTCGGCGATCTGCTCACGGGACCAGCCCGCAACTGGTACCGGCAGTTGAGTCGGACGACGCGAAGCAGGTGGAAGAGTCTGTTCGATGACTTCC
TGATCCAGTATTGCGGACGTGGAGTGTCTGTCGCGAGACAGTACTACCACGCGAGGAAGCGATCCGAGGAATTACCGCTCGAGTATCTACACCGACTGAA
CGTTGCTGGATTGCGAGCAAAGCTCCCGATCAAGGATGGATCGCCGGACGCCCGGCGAGAACACGTCGAACACTTCATCGAGACGTTTGACGATCGTGAC
CTGGCGGATCAGCTGGCGCTACTGATGATCGCCGAAGCGGGCCATCTCGAAAATACGCTGCGTGCGCGCCAGCGCGCCAAGACCCGCCAAGGAAAGGCAG
CAGTCGGATCGAGTAAGTTCCGCCAGAACgctgcatcgccagcacATCTGGCTCCCTCGAAACCTGCTCGCGCGGTCCGAGCGATACAATCGAAGGAAAA
CCTCAGCAAGTCCGAGTCGGAAGCCAGCGGATCACAACCAGAAGGCGATCTGCGCCCGATCTACCTCCCCCCATTCCGATCGTCAGGAACAAGGCAACTG
GCAGCCACCACGCCCAGGCGTGCGGGACCGCAGGATCGACTGGACCCGAGCTTCCAGGCGAAACAATGTTCCCACTGTGGATCCAGGAAGCATGACGACT
TGAATTGCTGGAAGAAACTGACTTGTGAGAAGTGCGGCAGGAAGAGGCATCCGTTGGACCCTTGCCTCTTCATGTGTCGGGCCTGCGGCGAACTGCACGA
TGCCAGCAAGTGCCCGATGGAGGAGTTCTACAACTTGATCCGCCAGTGGTACAACCCCAGCAAGCATGCCGGGATGTTGCCAGTCAACGCGGAGAAGATG
TTAAACTAGGACGCTCGTCGGGTATGAATCCGATACGAGCCGAGCGTTCTAGATATTGCATATTTGCATTCACGGACAAGACATCGGTGGATCAAGTTAG
CAAGCGACCCGATCGACACGATAATACATGTGAACTGCATGGGAAACGTACCGTGGCGATCTCAAGCCTGCGGCTGGACGATGAGTTCTCCAGGTCCGAT
GTCACGGTAGCCTTGGATCTCCAACTCGGGGAACAACGAGGTTACTGAAAGCAGCGGGACCCAGAGCAGTGGTTCGCCCCTGCCAAGAAGGAAGACACGT
CGGGAAGTCCAAGTATCCTGCAGGTCAAGACGGCTTGGCCATGTGGGGGCGGGGCGCTTCCCGATCTGCAGCCCGGAGAATCGCGAAGGTACTGGAAATA
TCATGCCCCTGGGAAGTGGTTCAAGCAAGCCAAAGCTGGCGCCAAGGTGAACAACGAGAAGGCCAAGTTGCTCTTCGACACCGGCGCTGAAGTCTCGATC
ATAGACACTACCTTTGCTCGTAAGGTTGGGTGTGTCATAGACGAATGTCAGAGACAAGAATGTGTCGGGATCGGAGAGAACACATATATGACGGTTGGAC
GTACCACGATCAAGGCCACGTTGGCTGGATCGATGGTGTACTACTTCGACACTTGGGTTGGCGGTCAGTCGGGGCAGGAATCGATACTCGGCATGGACTT
CACGGTACCAGCCGGAGTCCGCCTCGATTTAGCAGATGGGACGTTCTGTCTCCCTGATGAGGTTCGGATTCAGCTGCTAGGACGGCGTCCGCTGTACGGG
TCCAGCAAGATCTTGCTTGACCAAGATCTCGAAGTGCCAGTTGCCGAGTCCGTGGAGGTCCCGATCCGATGCGGCAGATCGGCTAGCGCGAAGCTCTGGA
TCACACGGGGTTCAAGATGGGTTCCGACCGCTATCAGGGGCCTGTGTAGAACGAGGTATCTCCAGATCACAAACGTGAGCGAAGAGAAGTTAGTGCTCGA
TCGGCACGCACGACTAGGAATTTGGTTAGCCCCAGACGCCGTACCTCGCATGCCCGGTTTTATGTCAGTCGGATCGCGCAGGTACGCTGAATGGCAGAAC
CTCGCGTTCGAGGCTACCACTGAACGACTGGAGGAGCCAGTATCCGAAGAGGAGCCAGTGGGACCGCTGGTAGATCGGCCTCGATatccgacgccgacgc
aAATTCTGAGTCGATCGGATGGGGCTCTCAAACCAGTGGTGGCCGTAGCGACCACCTTACCATCGCCCTGCGAAGGAACACGGGAAGGCCCGCCGGAAGC
CGAGATGAAGCGCGAAGAGCcggacgaagagcgagttGCCCGGGAGCCTGCACCGATCCGAAAGGAGGAGTCGACCGAGCCAAGCCAGGATTTGCCGAAG
ACCGATGTCGATCCTTAACGGGAGTCGATCTCGGATGAAGCTAAGGCAGAACAAGTCTGCTAccacgaaggaggaggcttGTTTGCAGAAGATCTCGAAC
AGAACTTGGTCATCTTGCCCGAGGTAGCAGCTTCAACCGAAGAAGTAACGATCGAGGACATTCAGGTTGGCGACCCCGCTCTGAATACCCCGGAAGAGAT
CGACCGGCTGCGACGGATCATctggcgaaggcggcacTTGCTGATCGGAAAAGGGAACGCCcagccacctgcagcacgcggtgcaGTTTGCGACATCGAC
GTTGGTGGTGCCACTCCAGTAGCCCAGCGTGTGCGACCAGTTGCTCCACAATTTCGAGAGAAGTTGGCTGCGCTGATCAAGGGTTTGCTGTCGGCCAGGA
TCATCAAACACTCGACCTCACCGTGGGCATCCCCGATCGTGATCATCATCAAGCAGAACGGTGTTGATATACGACTCTGCATTGATTACAGAgtcgtcag
cagcttgacgcgcttgaTGGTGTATCCGATGCCGTCGATCAACAATCTCCTGGAAGACTTGGATAAGATCTTGTGGTACTGCCCCCTTGACATGGCGAGC
GGATTCTGGGTGGTCTCCATGACTGAGAGTGCACGGTTGATCTCAGCGTTCATCACTCCGTTCGGGCTGTTCGAGTGGCTGGGTAAACCATTCGGACTGA
AGAACGCGCCTCAAATCTATCAACGGCTTATCGACAATGCTTTGTACGGACACTTGAAGATCAGCGCGGATCCAGACTTGAAGGAGACGAGTGACGTCTT
CGAGGAGGGCAAACCTGACACCGATCAGAAGCCGTCCGTCCTGGGGCGTCGATCgtacatcgacgacatcttAGTGACGGCCGAGTCTTAGGACACCCTC
TGAGCGAAGGTCGATCATCTGTTGGAGGCTTGCGAACAGTGGAACCTCTCGATCAGTGTCGTCAAGAGTGTCTGGGGACGCTGGAAGGTCGATTACCTGG
GTCATCAGGTGTCAGCGGGTGGACTAGAAGCCCATCCGAAGGATCTCGATTCCCTGGTCAATCTCCCGTTCCCACGTACGCTACGATCGATGCAGTCTAT
CTTGGGCAGCTTGAACTACTATAGCCGCTTCATTGAAGATTTCCCGATCTACGCTGTGATCTTGTACGAGCTGCGAGAGGTGGATTTCTATGAATTCCGT
AGACGAGCAGACGGCGCAGCTGGGAATAGTGACTGGGGGCGCCCGATCATCTCCTGAAGAGGAAAGAGGGCGATCGCTGGGTGAGAGCCACGATCACGTT
CACTCTGCTGAAGGCGGAGATCGGTTCTACGCCGATTCTCCGTCACTTCGACCCGGATCGGACTCCAGTCGTAGTGGTATACGCCAGCAGATGGGCGATc
gccgcggcgctgatgCAGGACCGTGACGGCGTGTACTGGCAGGTGCCTTTTTCACTAGCCGTACCTTGAAGGCGAACGAGATCAACTACGGGAAGGTCGA
CAAAGAAGTGTTGGCTCTCCTCCGTGTCTTGAACGGCTGCTACACGTTGCTCGTGACGCGATCGACCAAGGTGTTGACTCGTCACTCGACGCTGGCATGG
CTGGCGAACTCTTCTGGACTGGACGGCAGACTCGGTCGCTGGGCTGCGTTCCTTTCCGAATGGACGCTTGAGATTCGAAAGCGTGCGAAAGGAGCAGACA
AAATCCTTGGCACGATCGCGGCAAGCATCAAGCCTCGATTTGAAGTCGATGAGACGTTGGTCGCAATCGCGCCGAAGAAACAGCCACGTCAGGTGGTCAc
catgctgccgccgacaGTCGAGCTGAATGAGAGTCTGCTAGTCGTCAGCTCCGATGGATCTGCGAGCGTCAAGCGAAAGGCCGGAGCCTACAACGCGATC
ATATGGAAGCTTCCCGACTGGACGATCCTCgctgcgtcgtcggagtATGCGGCTAACCTGATGGTTAATGAAGCCGAATATCAAGAATTGCTGCTGTGTT
TCGATCTCCTGTCCGATCTGAACAGGGGGCGACTGGTCATCTGCGGAGACTCCAACTTGGTGATCAGATGCGCGGCGAGATCGACTCCAAAGCGCCCGGG
TTGCTGTTGTTACGAcagaaggcgctggaaaATTTGATATCATGGCCGAGACACGAGCTCTTGCACATGAGGCGCGATTGGAATCAAAGCGCCGATCGGT
TAGCGAGTGGCGCGCTTCAAagccaagaaggcgcagtCATTACCTCGGAGGAGGATCGCCAAGACTTGATCACTCTCAATCGACTTGACGAGTTGCTGAA
GCCGAAAGCGATCGACACGGTCGTCCGCGTAAGCGCCGTCACGAGATCGGCGATACGACGACCCCAACAGCCGGAAATCCTACAGGAAGCGATCGTACAA
CGCATGATAGGTGAGCGGATACGACAAGCGCAGGATGAAGAGAAGTGGATCGCTGATCTGAAGGATTACCTgaagggcgacgtgcaggagctgaccGCCG
AGGAAGCCAGGTTTTGTCCCAAGATAGCAGCTGActacgagctggacgagagtggcctgctcttcttctgcccCGCCAGGAAGTCGAAGGACGAGGATTG
CAATGCAGTCACTGGACTCGTAGTACCGGAGATCCTGCAACAGGACTTCCTGCATCACTACCGTGTCAATCTGGAGGGAGGCCATCAAGGAATCGGGTGG
ATTTAAACCTTTGCATCCGATTGCACTTTAACTGGCGAGGCTTGTATCGAAGTGTCCAGCGCTATGTGGGAGAGTGTACAGATTGTAAGACTGGGAAGGG
GCACCCCTTTGTTCAAGGAGAATCCCCTGGGAACGTGCAGGCCACTTACCCATTCCAGATCGTGACGACGGACCACATCCCTTCGCTGCAGAAGCCGTTC
GAAGGGAACACCGAGCTGTTGATTTGGGTCGACTTGTTCTCGGGCTACGCGATCGCGAAGGCGATCGCGTCGCGCACAGCGCAGATGATCGCGGAGAATT
ACGAGGAGTGCGTGTTTCGACGCTTCGGAGCCAGTGAGGCCATGCGCCAGGATCGAGAACCCGGGTTTGTGTCTGATTTCTTCCGTGCGTTCAGCCGGAT
AGTTGGACAGAAAGAGAAGGCCACGATGGCCTATCGTCCACAAGCCAACGACAGAAAAGatggtgcagacgctgacTCGCGCGCTCAAGATGTACGTCGC
AGACGTGAATCAGCAAGACTGGGACGAGTACGTGGAACGCCTAACGTTTGCGATTAACACGGCCCAAGATCGCGTCCGAGGCGACACCCCGTTTTATTTG
GTCCACGGTTGGGACGCTCGATCAACGCTGGAGGCATCTCTACCGCTGGGCTATACGCGGCGCCGAGACAGTGAACCGCGCCAATGGCGGTATCGCGTGC
AACGACAGTACCAACGGGCGAGGGAACAAGTCAACGAGCGCCTGCTTGAAGCAATTCAGGGACGAGCAGATCGGCATAGTGAAGATGTCCGACCCCACGT
GATTCAAGCGGGCGAACGGGTGTGGCTATACCTTGATCGTGTGAAGGAGGGCTATGCGCATAAATTAGCCCATATGTGGCACGGACCGTTTCGGGTGATC
GAGATGGTGGATCATCACCCTGCACGTCTGGAGACAGCTGGGACGGAGTATCGACTATTCCCCGTTGTACACGTcttgaagcagaagctggtgcggGCGT
TTCCCGACCGGCCCCATATCGAGCTGATGGGAGAGGATACGGATCGCTTTGACTTCGATGAGGCTCTCTTGCCGGAGGACAGCTGGGAGCGCAGTCTCAG
CGAAGGCGAGTATGAGGTGGAGCGGATCGAGGATATACGGAAGGGTCGGCGCACGCGCTACGGACACTTCCACTGCGAGTTTAAGGTCTACTGGAAGAGC
TACGATGACCCGTCGTGAGTCGACAAAGCCGATCTTAGCTGCggtgcgctgctgcgcgaatACGATCGTAAGATGACCACTCGCAATCGATTTGGGGTGA
TGCAGTCGCATGAGGAAGCGACGCAAGACCCGTAGCAGGTTG