Description :
From Genome Similarity Track
Location :
Scaffold_806:13- 6109
Sequence
6096 bases(100 bases per row)
CTGACCTCATCGCTCCCCACTCTAGTGGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACATGATGTGCCCGGTCGTAA
GCGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTCCACTTCACTAAGTACTGGGTAC
GACCCTGGCGTCTACGCCACGCCACAAGGCGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGGC
TCTCGCGGGGAGAGTCAGCACTTGCCGGAACGGCGTCTGCGTCCATACGACGCCGGCGTCCACGACGCGAACGTTCACGTTCACCGCCCATCGGTCGATC
TCGAAGAGATGATCCACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGTCGCTCGGCTGAACGTTCA
GCTTGCCTTGCTCCTGCATCTCGAGCACTTCGCTCCGCGACCTGTGACTCTGCCACATGCTGTTGATCAGCCATCTGTGGATCCACCACTTGCTGTCGTT
CAGCCTCCCGTGGCTCTACCACCTGCTGCCCTGCAGCTGTCCGTGGCCCAGCCACCGTTGGTGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGGTA
TGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTGAACGGT
CCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCACCGACCTCAAACC
TCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTTTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAA
AGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCACCAAGCCCTGAGCCACTGCGTGGC
GGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCATTGCATTATTTAATGCGAACTCAACGAGTG
GGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGG
ATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCC
TCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGC
TCAATCGGTCTACAAAGACCACTATACCCGTGTTTCACGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGG
GACAGGCAAACTCGTCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATC
TTGGGCCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCGTAGAGGATTCGATAC
TTTAGATCCTCATCATGAGGAACGACTACGCGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCG
CGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACGCTTCGCTCCCAAGAGCCCGTAGCAGTGCTACGCACATGTCGTCTTGTGCATACGCTCC
GCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCC
GGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACAACG
CATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCGTACTTCATTGCAAGTAGCTCTTTGTCATGAACTGG
ATAGATCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAATGCGATCACGCGCTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAA
TCGGAGGCGTCACAGACGACGCTAAGCGAACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGT
CGTGCTCGACGTTCCAGCACCATGGTGCATCCTTCTTAAGGAGATCTGATAATGGCCGTGCCATCTCCGCGTAATTCGCGCTGTACTTGTGCAAGTAATT
GGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTC
CCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTC
GCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGG
CCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCATTCGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGGGCTC
ACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGTTCT
GCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTCAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCT
GACACAGAACGTGGGTGTCGAGGGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCT
CTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCGCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGT
CTTTTGAGACAGCGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTTAGCGCCTTCTT
GGTGTCCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCT
TCGCCGAACTCGTCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGCATCAAGGCTGATATCGCCTTCTACCTCCCCCGTCACTC
CGTTCACGAGTGTATACAGCTGTTCACAGCAATCACGTGGAGCATCACCGCTCGTCACGTTGGACACATCGTCCGACGTCGAAGACGTCACAGACGCCCT
GCGTCTTCTTCTCCTTTCCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCGACATCTCCGTCGCCACCACCTGGTGCAGCAGCACCATCACTC
CTCGAAGAGGATACAGTGTCTTGCAAGACACTCGGCTGAAAGCCAAGAGGCTCTTGACCTTCACACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTG
GGCCACGCTCATGATGCCTCGACTCGCCGTCGACCGCGACCCTCGGGTCACGCGGCGGTAGGTCATCGACCAGATTCATACCACTCAGTGGATTACGCGC
CACTCCGCGCTCGTCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCCGCGGATAACGTGCCGCACCACGTACGCCCTCAGGGCAA
ACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTGGCAG
AGGTGGGTTCATGACTCACCTAAGCTCCACCAGGAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTCCAGTCGATCCATGGCTCATGACGTTCCAGCCA
TGCCATGCCAAGGATGAGGTCATACCTCGCATACAGGTCTAAGACCAGACAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACTCCAAGGTCGACAGAG
ACCTTCGACACAGCTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCCA
GGGTGGAGCGACGGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCC
CGGCTTGCACACACTCTTCTCGTAAGAGAGCTCAGCTCTCTTCGGGGCCTGAGCCCCGTTGCCCTCTACCTCTTCGAGGCACAACAGAACTCAGTTCTTC
CCCAGTAGGCCGCCCCGCGCCTACTGGGAGTTGCCGTTTCCCGGCGATGACCCGGAAGGTTGGCGCCGGAGCCTCGCGCTTCTTGCGCAGAGGGCAATAG
GCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTAA
GGTCCATCGGCTCTGGACCGCTCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCAACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCAC
CGCCTCTTCAAAAGAGTTAGGGTGTACACGGAACACTTCCGTTCGAGCTGTGCTCACACGAAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGG
AAGAGGGTCCGCCGCCATTCCGGCGATAAGAGCTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTTGACCGG
ACACGGTACGCCTGATTAGGCGGCGCGAGCACGCGCGAAAGCTGTTGCTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTA
GTGCCCATTCGCGAGCTCGACCTCCAAGCCTGGAGATAGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGGACCGATCCCATGGCCATCTCGACCTC
ACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGAC
GCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGAC
CTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCGCATCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTG
TTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGAGCGGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGA
AGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCT
TCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCCTGGGGGTAAATGTATCTGTTTAACTATCTAGCATAGTTAAACCTAATCA