Description :
From Genome Similarity Track
Location :
Scaffold_1765:13- 4990
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1765-snap-gene-0.3Dynein light chain intermediate polypeptide
Pytul_var.sporangiiferummaker-pug3_contig_1765-fgenesh-gene-0.2Protoporphyrinogen oxidase

Sequence
4977 bases(100 bases per row)
GTGCTCTACGGCGAGCCCATTTTCACAGGCGAGACCCTGGACCCATCGAAAAAGGGACCATCTTCGTCATCGTCAAATGGTGTCTTGGGCGAGAAAGGCG
ATGGCATTGGCCGCATCGAAGACATTCTCAATGCGATTCTCCCCCCACAGTAATATTGGGTTCTGTTGCTGCTGACTTTGGTCTGCTGTTGCTGCATTTG
GCACCAACAATTTGTGGTTTGTGCTTTGTCACTTTAGAATGTGGCGTGAAGAAGATACGGGGTACTGGATGCGATATGCGGCGCCCGTGCCGTCGACGCG
TTTCGACGTGATCAAGCTGCAGGAGGACATGGACAACAAGCTCATGAAGCGCCAGGCGCGCGAGAACGGCATTTGCCCCGTGCGCGAAGACATCTACCGG
CAGTGCTTTGATGAACTGATCCGCGAAGTCGCGATCAATTGCCCCGAACGCGGACTGCTGCTACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAACAGACGCGTACAAGACGCTATACGACAGCAGCATCACGTTTGGCATTCGCAAACAACTGCAGGCCGAGGACGGTATG
GGCGATCTCCAGGACCGCATCGACAAGCTGCAGCGCGAGAAGCAAGAACATGAGGACAAGGTCACGGAGCTCACCAACAAGCTCGAGCTGATCGAAAAGC
GCGCGACAGAGCGCAAGGCGCTCCAGGACAAGAAGTTTAAGGAGGAGCTCGACTTCCTCAAGTACCAGGGCCAGCACCTCGACGCGTTCCTGAAATCTGC
AGGCGGCGGCACCAGTAGCAGCAGTGCCAGCGGTGGTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTGCTGGCGGCGCACCAAAGTGAAAAA
CGAACTAAGCTACGTCCATTAGCGTTGGCAAGAAATGACAATGTAGTATTCAAACAATGTTTGCTAGTTAAGTCTCGGCTGCTTTCATCTGGTGCACCAT
TTTTGTGAGCACGGAATGCGCTGCCGTGACGTACTTTTGCTGCTCGTGGGCCACTTGGTCGCGCACGTTGAGCCGCTGGACTTGCGGCAGCAAGAATGAT
GCGACGAGCTCCTTGACGATCACGGCGTCCGAGTTGTACGTCTCCTCGAGCTGCATCACGATGTTGCTCACGCCGTTGGTCATGACGTTGAGCTCGTCCA
TGTNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGCCGATGATGTCGAGAATGAGGTCTGACGCTGTCTCCTGGTGCACGCGCTCGATGTGTCGAAACAC
TTCGTCTTCGCGGTCGCGCAGCAGGTCTTCGGCCTGCCGTCTTCCGCCTTCTTCGACCTCGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCATCTTGGCGATCTCCTTCGACCGATCGAGCTCCTTGTACAGGAAATCGAGCATGTCCGAGATCACTTCGCCCTCGGCC
TTGGCCAGCGTTGCGCTCGCGACCTCGTTGTCGTCGACGGCACCAGGTAGCTGCTTGTCTAGCTGATCCTGCTTGTAGGCTTCGTCGCTCGCGCGTAGCT
CTTGGATGAGCTCAGCACGACGCTCTTTGCCCTCGAACATCATATTCTGTACCGCGCGGCCTCGAATGAGTTTCTGCAGTAGCCGCACAGCGTCCGCCAT
ACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGAGGTCGCGTCATGACCTGGGCTTGATGCAGACTGCTGTGCCTGCTACGCAT
CGGCGTGGGACTGGACGTAGAGCCATGAGAAGAACTCGGTGATGTATCCTCGATGGTCTCCTTGCTTTTCTTAATGATCGACTCCATTTTCAGCAAATGC
GCTTCTATCGCGGCCTGTTTGCGCTCCTTCGCGGTCCGCACGCTCTTCTCTGGAGGCTTGAGCTTAGACNNNNNNNNNNNNNNNNGAAAGCAACATCCGC
GGCGGCACGGCGGCTTCCAATTCAATCAGAGACTCGATCTGCTTGTACTGCTGCTTGCCAATGCCGACCTCGAGGATATCCACTTTGCCAGATTTCCCAT
CGCGCGTCACCGGTGCATACACTTTTGAGCCAAAGTCCGTGTACTCCTGGATGATATCGCGCTTTGCTTTCGATGGAGACGTCAAGAGTCCGTGCTGCCG
CTTCTTGGTCAGCTTCCTCAGTGCTGTGACACGCTCTTGCTGGATGCGCTCTATCGTATTTTCCTTTTCGTGCACCAGCTTCGCGCGCAATGCCTCGACG
CGCTGCTCAGCGAGGAATTCGTTCTCCTTGTCGCGCTCCACGAGCGCCTGCTGTAGCAACGCGATACGCTGTGCGTGCAATTGGTCAATTTCAGCCTCTC
GGAACGCCCACTCGCGCGTTTCTTGGATCTCCATCATGGACTTCCGCAGCAAAAACGAGGCTTCGTCCGTCATGGGCGGTAGCGACGCGTCAAACGCCTT
CTTCTTTCGATTCCGCTCAATCAGTTCGATCTCGGCCTGACCCGCAGGCAGCCCCTGATTGTGGCGCAAGTGCAGCAGACTGAGCACCTCGGGCGGTTCT
TTTGCTNNNNNNNNNNGCGCTCTGGGACTTCTTGATCGTGTAGTCCGGCGTGTACGGGTCCGTTTGCGCATCCGAGTCGCGGTACATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTGGATCCCGACGGATCGGGTTGTTCCACTCGCCATTTCATGCTGTTCTTCACTGAGCCGATTTTTCAAAGTCGAGGAGGTGG
ATGTTGCTGGCACAGGTGGCGAGAGCAGCACTTCGGGCAGTTCGGCCTGCAAATGGGGCAGAATCGGGCGACGGAAGAACTTGGGCCGCTCGGCGCCACT
CACCATCGCATACCCAGCCATCGAGTTGTTGTTGCTGTTGTTCGAACTTGTCGCTGCAGTTGGGGGCTTTGACCCTGAGGCACGATACACTCCCTTGCTG
AATCGGCCTCCCGACCGCGAGACTGTGTAGACAGGATCTACGATAGCAACAATGCAGATCGTTAGCTTGGAAAATACGAAGAGGAGCCATGAGGAATCGT
GAACGTACCATAGACCGAGTCGAGAGCCCGCGTGGGCACCAGGTGCGCCATCTTGTCTTTGCTTTATACGACGCGGCAGACACACGGCATGCCACTGTTC
AAAAAAGCGGAGAAAAGGGCGAAAGACATACTTACAAGGCGGCAACCGTTTCTTTCTGGAGAAAATAGAGGTGACATTGACCAAAATAGGAGGTGACCTA
GGTCGTCGGCATTTCCAACACAGGGCGTCTCTGTAGATCGAGGGTATCTATTTGATTGCTTGCGCTGCACATGGAGGGTTCGTCAATTATTTTTCATCCA
CGATCGTCTTTGCATACTCTAACGCAAGCTCCTTGGACCGCGTGACGCAGTCAGCGAGACCGACGCCGTAGAAGCTGTTGCCTCCAAGACTCATCCCCGG
CGCAAGTTGACTCTCAATCGTCTCGAGCGTCTTCCAAAAGCCAACGTGATACTGAGGAATGCAGTTGTGTAGAACCATGCTGCGCACATAATCGGGTTCT
TTCGAGATGCCCAAATGGCGCTTTATGGCATCCCGTGCGAGCTTCTCCACTTCGTCCAGCCCCAAGTTCGTGATCTCCGGAAAATGGGCACCTCCACACA
TAACACTCAACCGAGTCTGCATGGACCGCGAGGTCGCGTTCTGTGATGGAAATGCGTTCGAGTCAAACACGACGCCAAGCACACGCTCACGCTCGCAGGT
CGGAACGAGGTACCCGAAGCCATCGCTGTCAAGAACGCGGTCGCTGAATCCAACGTGCACCATGCCCATCGACACGAATTGGATCTCCTGAAGCGTCTTC
GCGAGCGCTGGCAGCGAACTCTTAACAGCTGACGCCAGTTGGAAAGCCGGCAGCGTCGAAAATACGTGAGACGCTTCTATTTCGTGCGGCTGTGCGGCTG
TGCTTTCTTGCAGTTTGATGGTGAATGCTGGGAGCGACGAAGTTGAAGTTGAAGTTGAATGAGGTTGAATCGCGTTGACCTTGGTATTCAGATGGATCTC
CGATAGCGGGTCTGCCTGCATACCATTACAAAGGCCACGCAAAGTGAGCAAACAAATTTGGAAAGCCTGTACGCAACAATTGTACTACGACATTGCAGGT
TACCTGAATCTGGGCCTCAAGCGCGTTCATGAGCGTCGACATGCCATCCTGGAAGCTCACACTGACCGAACTCTCGTGGCTGCGCACAAAGTCCGACTTG
GTCGAGCCATCGAGCAGCGTGTCATCCCCAGAGCTTTTTCCAAAGAGCATCCCGCGCACGACAGATCCGTGCTCCTGCTCCAGGTCATACAGCATCTTGA
AGCACGAACGGACCGAGAGATTGCGGATGTCACCGCCAAAGATGCCCGATGCGACTGGGTCCAGCAGCCGCTCGGCCACCAACGGACTGAATCGGCGCGA
AGCAAAGGCGTAAATGGATTCGTCCGGGAGCTGCAACAATGCAACCAGCAGAAGCAGCATGAGGCACAATACACTCAACCGACTAGCAAATTATCACTCA
CAGCACTTCGCTTGGTGAACAACTCGTGCACGCCGGCCTTGACGAGCTCTTTCGTGAGTGGCCACGTGAGGATTTCGCGAACACTCGACGGTAGTTTCTA
TATAGAAAGCCCATCGATTAACAGTGGGTTACCATTAGTGCAACCCAAACACCCACTCAGGCAGAGAGCGTGATTACCTCGACGTGCCCATTGCGCAGCA
CATAGCGTGACTTGGCGGCCGCGTCCACCGTGCGCATGTCGCGTTGCAGATCCAGCTCTTCCACGAGACGCAGCATCTCGGCGCCATTGCGCGAAGGTCG
GAACCCGCGCGGACCTTCTTCGAAGAGGAACTCGCTGCGCTTGGCTGTGCGGATCCAACCGCCGGCGTGCGGCGCAG