Description :
From Genome Similarity Track
Location :
Scaffold_2387:13- 4077
Transcript NameFunction/comments
Phyta_totarag14441hypothetical protein

Sequence
4064 bases(100 bases per row)
TGGCGTGATCTTGGCCGCTCGTGATCTTGAGGAACCCATACAGCGTGTTGTCCACCAACCTCTGGTAGATCTGCGGCGCGTTCTTCAATCCAAACGGCAT
TCGAATAGCCCGAATGGGGTAATAAACACTGAGATCGCGCGCGCTCGATCAGTCATAGAGACCACCCAAAATCCACTAGCCATGTCCAAGGAGCAATACC
AGAGGATCTAGTCAAGATTGTCGAGTAGATCATTGATAAGAGACATAGGGTACACCATTAGTCGGGTCAGGCTGTTGATCAGGCGATAGTCGATACAGAG
TCGGATATCGACTCCATTCTTCTTGATGGTCACGACGACCGGGGACTCCcatggcgacgtcgagtgTCGGATGATCTCGGCTGACAGTAAACCCTTGATC
AGCAGGAACAACTTCTCGCGGAATTGCGGCGCGACCTTGCGGACCCGTTGGGCTATCGGTCTTGCATTCCCACATCAATGCCGCAGATCGCTGCCTTCGC
AGCAGGTGGCAAGGCGTTCCCCTTCCCAATTAGAAGGTGTCGGCGACACCAGATGATCTTCACTAGTCACTCGATCTCTTCCGGCGTACTGTCCTCAGGG
TTCCCCACTTGGTATCTTCAATATTGACTTCTTCCGTCGTCGATGTGATCTCCGGTAATACTGCCATGTGACCCTCAAGATCTACTGCGTAGAGCTCACC
TCCTTCTTTAATGCACACCTGTTCGTCTTCCGCGTGTCCTCCCGCGTAATCACCAGCGAGATCTTGTTTACTCTCGTCCGGGTCCTGTCTCAGTGTCTCA
GGTTTTTCTCCAATCCCTGCAGATCGATCTTGAATGCGTTTCTGCCTTTCACCCATCTGTGCATCTCGATCTTGGCAATCACTTGAATCCTGACGTCTGC
AATCTTTTGCATACATCGCCCTTTCTGCACCCGGGACTGGGCGCTTTGTACACTCATCAATGTTGACGTGTACCTTCCCGGCCGGCGACAAACCCGCGTT
TCTTCCGTCGTTGGGGCGCTCTCTCGCATAATCCTTCGGTCGTGttctccgccacctccgccgtcgccactGCATAGCACTGCCACTTTTGGCGGTCGCT
CCGGCGGCCGAGGCAAGATCGCAGTCGGTGTCTTGTACAGCGGCCGATTTACGGCAGGCTCCTGTGGTTCCTCAAGTTCCTGGTGATCTTCGCCGACATC
TACCGTCGCCTGGTAGGCCAGGTTCTGCCATTCGACATACCTGCGCGATCCCACCGAGACATATCCAGGTAAGCGAGGTATCCGATCTCCGGCCAGCTAC
ATTCCGACGCGCATGTTGCGATCCAGTACTAACTTGCGATCGCTCACGTTTGTCAGCTGCGGGTAGCGTGTCTTGCCAGGGCCTGCTATCTGGGTAGGCA
CCCAGCGATCTCCGCGGGTTACCCACAGCTTCCGACTCTCGGCTCGCAGCTTCACCTCCGTCGATcctccgacgtcgacgtaTCGATCTTCGTTCAAGGT
CACTTGCTCCACACGCTCTCCGTAGAGTGGTCGTCTACCGACTAGCTGGACACGGACTTCGTCGGGGAGACAGATAGTGCCGTCggcaagatcgaggcgg
atACCGACCGGGACCATGATGTCCATACCGAGGGTCAAGTCCTGGCCGCCAGTCGGCGGGCCGACCCAGATGTCGAAGAAGTGATCAACGATCCAGCGAG
CATGATCTTGAGTCTGATACGTCCGGCCGCCGTGTATGGGGATTTTCCAACACCTTCACATTCCAGTGTCTGACTTTCGGCNACACAGCAGCGGTAGGTG
TTCCATGAAGATCACATGTATTGTCGATCGGATTCATCAGCTTGCTAACCATCGACTCCGGTTGTTTCTCGACATATGCATAGACGTAGTATCTAGAACG
CTCGTCTCGTACCGGGTTCAAAACCGGCGAACGTCCTAGTTTAAcagcttctccgccgtctccggCAGCATGCCTGCGTGTTTGGTGGGGTTGGACCACT
GGCGGATCAAGTTGTAGAACTCCTCCATCGGGCATTGGCAAGCGTCGTGGATCTCACCGCAGGCTTTGCACACAAAGAAGCATCGGTCGGATGGATGTCC
CTTTCGGCCACACTTCTCGCAGGTCAAGCGTCCCCAGCATCCAAGATCGGTATGCTTGCGCGACCCGCAGTGTGAGCAGCGCTTGAACGACGTCCCCAGG
TCAGTCGACCTGGTGTGTCGATCTTGCTGGTGGTTCCGGCTCGTGGGGCCTGTGCGGTCACGGTTTTAATCCGGTGGCCCACGATCTGGTGGCTCGCCAT
CATTCCTAGCTGCCGTCAGGTAGACTCGGCGCAGTCCTGCTTCGCCATCCGATCCGCTCGACTCCGCGTCCGACTCACTACTCTCGTCTGCCACGTGGAT
CGCGCGAACTGCTCGCGTGGGGGCTGACGGTGTGGCTGAGGTCGGTGCTCTCGTCCGGGGCTTGATCGACCCATAGACGTTCTTGCTCTGACGCACCTTC
TCACGCTGTCAAGATCGAAGCGTCTCTTTCAAGGTATCGGCATCTGGGACTCGCAACAGGGCGAGGTGGTCGGCGAGAGCACGGTCATCCAGCGTCTCGA
TGAAGTGGTCGACATGTTCACGTCGGGTCTCTGGAGATCCATCCTTCGCCTGGAGACGTGCACGGAGCCCAGCTACGTTGAGACGGTGCAAGTATTCCAG
CGGCGACTCGTCCGATCGCTTCCGGGCGTGGTAGTATTGTCTCGCGACAGATTCACGACGGCCGCAGCACTGCGTCTGGAAGCTCAACAGCAGATCTTTC
CAAGTACTGCGAGTCGTGCGGCTCAACTGCCGGTACCAGTTCCGCGGTGGTCCAGTAAAAAATCGCCGAAGACCAAGCACTTCTCATCATCAGGTGCTTG
GTCTCGGATGAACGCTGATTGCGCTTTGCCGATCCAGGACCGGGCTCGATCTTCGTCGCCCTCCTTTCCGGTAAACTCCTTCAGTTCGGACATTGCCGAC
ACGTGCACGCGTGGGGCGGCTGTCGATCTTCCGACCTGTgacgttgttgtcgtcgcgactgctgcgcgagtAGTCGTGGTAAGATCGAGGTCGTCGGGAT
TGTCGGGATCGTATTATCATGGAGAGGAGTGGCGATCTGGCGATCCGACCGACACATCTTGATCACCAGTCGGTTTTGCGACACGTTGGCGGGGAGTGGG
CTGCTGTTCCTTCAGGAAGCGTCCCATCGCATCTTGAAAGTACGACTCCAACCACTCTGACGAGCGGCGTGTCGGGTTCACTGCTGCGATCTTCGTCTCT
TGGACCGAAGTTACTGCTTCGCGCTCAGCTCGGTCAGCTCAGTTTCGCAGCATGGCGGTGCCGGAAGGTCCCAGCGTCATTCGCGGCGGGTCCTCGACGC
TGTCGGAATCTACTTCTTCAGTCGCCGACTCGTAGTGCGACGACGTGCCAGTCTGGTCGTCTGGAGCGAGTGTTGGCTGCGATCTCACAATCTCCTTTGT
GGATTGGCTGATCGTGCCAACCAGGGATTCAGCGTCGCGAAGAGAGTCTTGAACACATGTTCGATCGTGCCAAGCTTTAGgtcgaacagctcgtcaGCTT
CGAACGCGCCCGCGATGAATCCAGATTCCttcagcagttgaagcacACCTTCACCGCGTCCAGCTTACTCGACCCAGTGATCGGTTTCGACACGGGACCC
TTGAGATCGTCCAGGATCCTTGGTCGGAGAACCAACATCACTGGGTTCTGGATCAAGAAGGCATGcaagttcttcttgtggtaggcagcttccagctgct
cctcggTCTAGGCTGGCACAGNTTGCCGGGCCCTCCTCTGTTCCGTCGGTAGAGCTCCTCCCAGAACTCTGCGGATCTGCGGATCGATCTTGATTTAGCA
GCGTCGTCAGTGATCCGATCTCCGTCGACGCTTGTTTCCCTTGTCCTTTCTGAGCTTGTGCTTCCTCTTAGAGGGACTCACGGTGAAATCCCGAGTCACC
TATAGATCAgggcacgcgcaccattgtggtgtagtgggtctgcgaaaattgctagTCGCAGGAC