Description :
From Genome Similarity Track
Location :
scaffold_956:13- 4000
Transcript NameFunction/comments
g10697.t1hypothetical protein

Sequence
3987 bases(100 bases per row)
AGCGGAGTACCCCCTCCGTCAGTCAGGAGTCCGGACGCCAAGTGTGTGAGTGCCCCTCGCGTCGAGTTTCCTCGCGAGCCACTACGCCACAATGGTGCGC
GTGCCCGGATTCGAAGGTGACTCCGGATATCACCGTGAGTCCAGCCAGGAAGATGCCAAGATCAAAGTTGAGCCAGGAACCGGCGCGTCAACGGAAGGTG
AATCGCCGTCATCGCATCTGAAGAGTGAAGGATACACCGAACACCAGAGCACTGGGAGGAACTCTGGCGAGGAACAGGAGGTAGGTTCAGCGATGGACCT
GGAAGAGAAGCCTCACCCTCCTCCCTTCGCCCCCCCCCCTTCCCCGCGGATCGTGATGCGAATCGTGATCCACAACCACTCTCCCCACACCCCGCGTCTC
CACAAAGAAGAAGTCGACGACGAAGCCGAGAATGAGGGCTCCAGACGTGGAGGAGAGTGGAGAAGTCAGGACCTGGACTCCGGATCAGCTACAGAAAATC
TTCTACCGGAAGCAGCTCAACGCTTTCCTTCTGGCCGAAGCTGATCGGAGAACACCAAGGCCCTGTGACCTCCCCGGTTCAAGCGTCCGATCTCATGGTC
GCGATCACCAGCCTGATGAACATGCTGGAAGAAGCCGGGATCGTCGCTGGTGCATTCGATGCGGAAGCTCTATTCGAGCTCAGTCTGGCCACGGTCGACG
AGTCGTCCAGACGCTTGTTCAAGCTGCTGAGCCGTTGGTAGACGTGACTGCGTCGCTGTCGAGCCTTGGCCCGACAGAGGGATACCCCACCTCTGCATCC
TCGCACTCAGGATTCGCGTCCGCGAAGGCGTCTGTTTCCTCAAACGTCGGGTCGGACGGCACGATCCAACCAGAAAGAACGACGCTCGGTCCATCCGGTG
CGGCCATGCTCCAAGCGAGAAAGATCAAGGAGGAGAAGGTGCCCGTCAACACCAGGGCGGCGCCTAGAGCGATGCCCGATCTCCACAATCCTGATCGTAT
GCAGTCGTTCTTCAACACGGCCATGGAACGCTTCCTGAAGGAGCAGACCGTGGGGACGATCACTGACCAGCCCAAGACGCCGACGCCGGGGACGCAGGAT
GTTGACATGGAATCGATGGAATCACTCCACGGATCCCCGGACGAGTATGATCCCGACGACTTGAGCATCGACGTCCCACGCCGAGCTGCTGTAGCCTTGG
CAGAGACGACCACGTCGTCAGAAAGCGCATAAGCAAATACCCCGCGTCTGGATGTCGGCGATCTCCGAGCTGAAGGAGTTCTTTGGCAGAGACACTGAGG
AAGATCGTGCTCGAAGCTGGCTGGGCAAAGTGAAGTCCGCATTCATCCGCGATCAAGCCCCTGATAGTGAGAAGTGCAACGTCTTCGGGAACCTTTTGAT
TGGCCCTGCGCGAAACTGGTACCAGCAACTGGGAAGATCGACCCGTGGCAAATGGAAGGATCTCCTGGACGGCTTCAGAGTCGAATACTGCGGGCTGGGC
GTGTCTCTCGCGAGGCAGTACTACCACGCGAGGAAGAGATCTGACGAGTCGTCACTCGAGTATCTCCACCGCCTGACCGTGTTAGGACTCCGAGCCAAGT
TGACGATCAAGACTGGACCGCCATCCGCTCTCCGAGGACACGTGGAGCACTTCATCGAAACCTTGGACGATCGCGATCTTGCGGACCAGTTAACGCTGCT
GCGCCTCGCAGATGGGGACGCGCTGGCGAACGTGTTGAGTATACGTCAGCGCGCGAAAGCCCGACAAGGCAAGGTGGCTGCTGGATCATCCAAGTACCGT
CAGAAGGCTACATCAGCACCTCCGCAAGCTTCGTCCAAACATGCTTGAGCGGTGCGTGCAATTCGCATGACGAACGACAGCGACAGTTCGGGATCGGAGT
CAGAGTCCGGAGGGTCGGACCTGGATCAAGGCCGGTCTCAAATCTACATCGCTGCTGTCGTGGACCAACGGAAGCCGGAAGATCAACCTCAGCAACGTCG
CGATCCCCAGGGGCCGCCGAGCAAACCGGGTCAAACCCCTCGCCCCCGAACTGAAGATCGTGTGGAGAAGTGTTCCCACTGCGGGTTCACGAGACACTCC
GATCTTGGGTGCTGGAAGCGTCTGACTTGTCAGAAGTGTGGAGAAGGGGTCATCCTGGCGATCATTGCTTGTACGTTTGCCGAGCGTGCGGTGAAGTTCA
TGAAGCCGGTGAATGTCCGATGGAAGAGTTTTATAACTTGATCCGCCACTGGTACGATCCCACGCGTCACGCCGGGATGTTTCCCTCGAAGGCGGAGAAG
ATGTTAAACTAGAACGCTCGCCAGGTTGGAATCTGGTACGAGCCGAGCGTTCTAAGATCCGCATATTTGCATACGTTGACAGGCAAGCGAAGTCGAAGGT
CAGTTCTCCGAAGGATCCTATCAACAATACACGTGGAATTCATGAGAGACGTACCTTCACGATCGCGAGCCTGCGGAAGGATGAGTATGCGCGATCGGAT
GTTGTGATGGAGTTGGACTTGGCTGATGAAAAAACTCGTGGATACTAGAAGAATCATGTCCCGGATACGAAGCCTGGAGAACTCAAGGCCGTGAACTCGT
TGACGAGGAGCCCACCGGATCTCGGCTGGGATCTTCGACCGTGTGAATCGCGAGGGTACTGGAAGTACTACTCGCCCGGCAAGTGGTTCAAGCAGGCGAA
GATCACCGGGAAGATCAACAATTCGAAGGCGACAATGCTCTTGGACTCTGGCGCAGAAGTCTCAATTGTGGACACCACCTTTGCTCGTACGGTTGGCTGT
ATCAAAGACGAGAGTCAGAACAAGAATGTGTTGGAATCGGAGAGAACGTATACACGACTTTGGGGCGTACCACGCTCAAGGTCACATTGGCGGGATACCT
GGTGTACTTCTTCGACGCTTGGGTTGGTGTCTTGGCGGGTCAGGACGCGATCTTGGGCATGGACTTCATGGTCCCCGCCGGGATCCGACTACATCTCGCT
GACGGCACGATGTGCTTGGCCGACGAGGTCAGGATTCAGCTGTCAGTACGACGCCCGCCGTATGGCCGAAGCAGACACTTGCTGCTGCTGGAAGATGACG
TGGTGATCCCCGTAGCAGGAGCCGCCGAAGTTCCCCTGAAGCCACCACGCGCGTTAAAACGAGAGAAGTTGTGGATCGTGCGTGGAGAAGGATGGGTACC
TACCGTAGTGAAGGGGCTTGGACGCAGACGACACCTGCGGATCACCAACGTCGGCGATCAAGAGCTTCACCTGCCGCGAAGTACCGAACTGGGAATGTGG
CTCGCTAAAGATCTTGTTCCCCGCGTGCCAAGTCACGTGTCGGTCGGATCTCGCTGATATGCAGAGTGGCAAACTCTCGCATTTAAGGCGACTACCGACC
GACAGGAGCACGAGGAGCTGCCCCTGAGTCTTCCGAACCGCTGGTGGTGCGCCCACAATACGACCCTCCAACGATGATCTTGATGAAAGGTGAAACGGCT
CCTCGTCCATCAGTCGCAGCGGCTACCGTCCGTTGGGCCGAACCCCTTGTGGCTAACGCGGACATCTCACAAGCCAAGTTGGACACGGAAGAGGAGATCG
CGGACCGGGATGATCCAGGGAGCGCGAAAGAAGAAGGATCCCCTGAGCCGGAAGCTGACCTCACCTTGGACTCCGAAGAACTGATGCCTACTCCAGCTGA
AGACGTCGCTACGGAAGAACTCCAGGGAGAACCGAAGGACGACGTCTCGGAAGAACCCGCCGAGATCCGGGAAGATGCTGAAGGTTACTATCACGATGGC
GGAAGTCTCTTCGTGGAAGATCTTGAGGGGCAGATGGCTGTCTTGCCCGAGATCGTGAACACGACCGAGGAAGTCAAGATCGAAGACATCCAGGCTGGAG
ATCCCAAGTGGAATACGCCGGAGGAGATCAACCGTTTGAGGCTGATCATCTGGAGGAGGAACCACCTGCTGATCGGGAAGGGGGACG