Description :
From Genome Similarity Track
Location :
Scaffold_1608:13- 2489
Transcript NameFunction/comments
Physo_145543H0413E07.4

Sequence
2476 bases(100 bases per row)
TTCACGACATGCCACGTCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGTCGCGTAGTTGTCCCCGTTGAACTTGTCAATGGAGACCTTGG
TCGAGGCGTCTTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGGATCTTGGACACGAAGCTCGGACGAAGCGGAGGGAGGGACGT
CGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAATGAAGATTCGAAAGTGATTGAATTGTTGGAGCTTACACCCTACTGTTATAGACACGCG
ACCCTGCGTCCTATCACCTAGTGCATCTAATCAACCATCACTCACCGGTGTTCATCCAATCATCCTACTCGTCTAATCATCGGTGGCGTAAACAACTTAC
CGTAATCACCATAATCAACGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATGGGTACAACTGGTACACAGTACCCAAGACCAGCAACCCTCAA
TACTTGTTCTTCAGTCGGAATAGGCACCCAGTGCCCGCGCTCCCAGATTGCCTGTGCGTGCTTGTGCATGATGTCTACGACGTCCTCCATCAGCTTGAGC
GCTTTCGTGGAGAGCAGCTCTCGCTCATGGAAGTAGAACACTCGGAAGCGACCCTGAAGCATAGTCTCCCAGGGTTTAGAATCCAGGACTTCTTGGTATG
CCTCACGGTCCCAGCGCTCGTGAACAACGTCGTACGAATACTTGTGGATCTCGTATTCTGGGAACCCAGGAGTCTGGCAAGACGCCCTCTTGGTCGAGCT
TGGATATTGCACAAGAACCCCATAGATGCGCCAGGAAGTCTCGTTGTCCTCAGGGTCTTCGGCCGTCATCAACTCACTGGAAGTGAGCTCCGAGTATGAT
TTCCGCGCGAGCGCCGACGGATGCTTGGAGCGTGATGTAGCCTTGGACCCCTGAGTGGCAGAAGTGTCTTTCTTGTTTCCTGTGCGACGCTTTTTCTTCG
ACTTCGAGTTGGAACCCTGAGGTTTCTTGCTTGATTCAGAACGGGGGCGCTTAGCAGGAGGCTTGACTTCCAGGGGTTCTTCTACCTCATTGTCGTCCTC
TGCGTCGTCGTTGTCCTCTGCGTCGTCGTCGTCCTCTGCGTCGTCGTCGTCCTCTGCATCCTCGATGTCCTCCAGAGTTTCAGGGGCGACCTCCTCCTCC
TCCTCTTCAGAGCTCCCGCTAGAGGCGCTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN