Description :
From Genome Similarity Track
Location :
Scaffold_2609:13- 2299
Sequence
2286 bases(100 bases per row)
CCGCTGCCCACTGGAGACCGAGAAACACGTCGACCTTTCCGATCACTCGGGGTAGGTTAATATCCCTTAAGCACTTCCTCCTGTGCAAGGTTGCTGTGTG
ACCCCCGTCACACTTGGTAGCACTCGTAGTCACTTCCAGCACCATCCGCGGGTAGATTGAACCTACCTGAACCCTCTGTGCGCTCCATCGTTTGAGCCAA
GATGGACCCGAAGCGAGTTTCCCTCGCTTGAACGACTCACAGTACGAGTCTGTTCGGAAGATGGGAGGCATCTTTGGACAAGATGTCCTTCGCAGCTTGG
CGGCGGCGACGCCTGCCGAGCAACAAGAACGCGTGACCGCGTTTGAGACCTACGAGCGTGATCTCATCGCTCACGTCCGCGGGAGCTTGGAGGCCACGAT
GGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTGTGGCTGAAGGTCCCCGCGTTTGAGGGGAAGGAAGGAGAGAACCTTCACTTCTGGGTCCGTGAGGTG
GAGATCGCCATGAAGGCGGGTCTCATCTCGGACGAGTCAGTTCGGGTGGCGTTTGCCCTGTCCAACCTTGGTGGACGTGCCAAGCACTGGGCGTACACCA
GGGAGACGACATCTCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCATCTTCGAGCCGCGTTCCTACCGGCGAACAACGAGTTCCGCCAGCGCTC
ACGCTTTCTCGCGTGTAAGCAAGGCAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACGTTGGTGGCATCTCTGGCAGGGAATCCTCTGCCTGAA
GACATTAAGACAACAGTCTTCATGGACGGCCTGAAGGTCGGTCCTGCTCGCACCCAGCTATTCCGGGTGCAAGCGACAACTATGGAGGAGGCGATACGAA
TCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCCTCGGGAAGAGGAACATCGCCACGATGATAATGGCGTTCCTCGGGAGGCGGAGCATCG
CAGCAATGACGCTATTGCTCCTGCTGTCACGCAGCCCGTTGATACCGGCGCGTACAGCGAGCCCGAACTTAAGCTCAGCCGAGAGCTTGGTCAGCTGCTA
TGGATGCGGTGGACAAGGGCACTACCAGCGTGTGTGTCCCTCGCTTGTCCTCGGGAAGAAGACAGCCCGTGGACCCGAAGTCCGGTGGCGCAGGCCACGG
CCAGGTGGACGAAGACGCCCCGGCCACCAGTAGAGGCGGTATGCCCTACGGAAGAGCGCTAAGCCTTCGTGATGTGTGTGCAGGTTGTGCGCACCACGGG
ACTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGCAGTGATGGGCTGCTGGTAGTACACTCGGTGTACGGGGGTACGGTACCCCTTGAACGT
TTGATTAGTTCTGGGGGGTTGATACGCCGTCGGAACGTCGCTTGGCATAGCGACATCCGACTGCACTCTATGTCAGAGTGGCGGTCGTGGGCTAGTCCTT
GGTGGACTAGCTTTTGGTACGGTGAAGGAAGTACCGATGGTTCTCAACGGACCTGAACGTTTCGGCTCGATGAACTCGCGCATCGCGGTGTCGCTCGCAG
TTCTCGCCATGAACAACATGGCTGTGCCGAACATAAAGCACAGCCCGGACTTTGGTGTGGCAAGGCTGAGAAGGGCCTCCCAGTCCAGGTCTATGACGGG
AGCATTGGCGAATCAATGTTCCCCACCTCCGTTATGAGTGGAGCGTCTGATACAGACCCGCCAGGACGCAGAAGCGTCACGGAGCTGTCGACGCGCCGAC
AGCTCTGCGTACAGCAAGCCCCTGCTCCGCTGTGGCAATGCTACGGGCATGGGTCTTTTGCCCGGCGTGTGGACCTGCTACACCAGCAGCGTCCAACGCG
GAAGTTCGTCGCGCCGTACGGGCTTCGACAGTGCTTATGCCTTTAAGCGCTAACCAGGTGAGTAACTTAGGACCACACGGTCGCCCATACCTTAACTGAA
GAGGAAGGCGCTGAAAGCGCTTCCTGTATGGATAACACAGTACCACACGCAGTCGCCCAGACTATAACTGAAGAGGAAGGCATTGTCCATGCTTCCTGTG
TGGGTTACCAGTGCCACACGAGGTCTCGAGTGCCTCTGATGTCTTCAACGAGACATCACGACGTGGGGTAACAAAGTGCTACGTCACGTCAGCCGCCGCA
AGTCGGGTCTGAACCTTGTTCAGGCCGACGTCGCTTCAAGCGACTCGGAGTCCCAGGTCTTGGACTCCTCTGACTCGGTCGGTGGA