Description :
From Genome Similarity Track
Location :
Scaffold_2576:13- 2039
Sequence
2026 bases(100 bases per row)
TATATACTTTTAATAATTAGTGCACAGCCTTTTTCCCTTTTACTTCGGTTAACTTGAATGCTCCTCGCACGGTCATTGGGCCCCCGTCCCCATCACCTCG
AGGCTGTCACTCACCTCTTGCTCCATGCTGCGAGCCCCGCTCATTCCTATGAGCCGGCTGCACCAGCCCACTAGTCGAAGCTTGAGCTCAGCCACCGACC
TGTCATCCCCCGCGTTCTAGCGGCGGGAAGCGCTCGGCGCCTGACGACGCGGTCGTACGCCGTAGCGGCGGGGCAGTGAGTGTGCCCGATCAAAAGCGTC
GACGACGTCAGGGCAGTCCTGCCGGAGGACAACCTCAAACTCCCAAGAGTTTTGTGAGTGAGGATAACCCCTCCATTTCACAAGGTACTGAGTACGACCC
TGGCGCATGCGCCTCGCCATCAGGCGTTCCACATGGAAGTGGAGCTCGCCGTGCTCATCGAGCAGAGCAGGAGGAGGCCGAGTCTCAGCTGGACTCTCGC
GTCGCGAGTCGCAGCGACGTGTTCGCGCTGGAGCAGCGTGTGGGTTCCCTGAACCGGTATCTCCATGATACGACTGACTCTCTGAGTCGCCTTGCAGATG
GTCTCGATGAGACGAACCACCGCGTGGACTGGTTTGAACAACCACAGTCGGTTCAGAACCGAGTCGCGGACCTTGAGCGTCAAGTCGCTCAGCTGCAAGG
TCAGATCGACTTGCTGTTGCGTCTTGTGGCCCCGCCACCTGTTGTCGCTCAGCCCGCCGTGGTTCGGCCTCCCGCTGTTGTGCAGCCTGTCGTGGCCCAG
CCACCGTTGGCGCCAACGCCTCCGCGCTCACCTGAGCAGGGTTCTGATACGGCTTGAGTAAGCCAACGTAGAAAACTGGATGCGTGCGCATCTTCTTCGG
AAGGTTAAGCGTATACGCTAGGCCCTTCTTGGCCACGACCTTGAACGGCCCTATGTACCGTGGTCTCAATTTTGTCTTAAAGACTGCAGACACAGCATGA
GTAGGTAGGTTTTTGGCATTTAATAAAACTAGGTCTCCGACCTCAAACCTTTCTTCATTGCGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATGTATT
GGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTGCGAGCCGCAACAGAGCTGACATCAGCT
AGCCGCTCGGCTATCTTCCCCAATCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGCGTGTA
GCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATCCGCTTCGGAGGATA
TCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCGAACGAGTGCCGAGCACTCTGAAGAGGGACG
CCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAAACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACC
TTCACCATCAATGGTGTCCCGGCACTGCCGCTGAATGAGCCATCTTGCTCAATCAGTCTACAAAGACCACTGTACCCGTGTTTCCCGCCTTATCCTTGGG
AAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGAATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGT
TGACACGTCTCACACGTGCGTTCATAGGTGCCGACCAACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTA
AGTGCCCGCCCACGGGCGTATCATGAACCTCGTAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGT
GCTGTAGTACAGCAGGCCACCATCGA