Description :
From Genome Similarity Track
Location :
Scaffold_3139:13- 1802
Sequence
1789 bases(100 bases per row)
AGGGCCGAGCATCAAGATCTCGTTACGTTGAAGCGACTAGATGAGGTGGTGGGTGGTTGGACCCGGGAAAAGGACAGTCAGGTAATTGTTGTCACTAGGT
CCAGGGGAAGGATTGGATCCAGCCCCCAGATCCTCGATGAAGCATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAGAGCACAGAACGAAGAAGCGTG
GATCTTGGGACTAAAGAAGTATCTGATGGGCGATGTACGAGACTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAATGGATC
TGAATGACTTGCTCTTCTATGTTCCCCCTACGAAGAAGTCGACGAGATTCGGAAGGATTATGGAGATGGTGATGCCGAAACCTTACACCAGGAGCGGGCT
AACTCCATCTCCACGTTTATTTTGAGAGGGCGGACCTCCGGGTTTTTGGTTCGACCCTACCACAGATTTCGCGAGGAATTTTCCCACTGGAGGGGACTAT
TCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGACCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGAC
TTACCCTTTCCAGATCATAGCCATGGATCACATCCCCTCGCTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATCTGTTTACCGGA
TACGTGATAGCCAAAGCCAGTGCGTCTAGAACTACGCAAACTATTGCCGAATCGTACGAGGACTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGGTTA
GACATGATCGGGAGCCAGGTTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGAGGCAGAGACAGCGAGCAACCATGGCATATCGTCCCCAAGC
TAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAATACGCAGAACGA
CTCCCCTTCGCGATGAATACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGAATCCCAAATCCACCCTAGAAGCAGCCA
TTCCAGTGTGTAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGGTACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACG
GCTGCGGAGTGCGATACAGGATCGAGCGGATCGACCCAACGAAGACGCCCGTCCACATCAAATTCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGA
GTGAAAGAAGGGTACGCACGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGTAG
GTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCCGGATCGGCCGCAGATCCGTCTTTCAGTGGATGTAT
CCGACCGCGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAGGATCACCGATATGAG
GTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAAC
TGTGGAGCATTACTCTATGATTTCTTGCGGGAACGTACGAATCGGGACAGATTCGGCTTGATGCAGTATCATGAAGAAGAGTAGGAAGG