Description :
From Genome Similarity Track
Location :
Scaffold_3943:13- 1742
Sequence
1729 bases(100 bases per row)
CGCGGCTGGCGGCAGGGCGTTCCCTTCTCCGAGAAGAAGCTGCTGTCGGCCCCAGATGATCTTCCTCAACCTAGTTTCATCCTCTGGCGCGACAAAGCCT
TCATGCTCGATTCGTACGTCTTCAAGCTTCACATTTCCTGGCGTCGTCGTCACCTCTGGCAAGATTGTCAACTGAGCATCTACGGCTTCGGCAAAGAGCT
CGCCCCCTTAGCTGATGCAGACTTGGTCATCTTCCACAGGGGTCGTGCTTGACGCATTCACAACAGGCTCCAATTCCATCGGATTCACGATCAGATCAGC
TTCTCCGTCTACCCCGCTCCCAGGTTTGCTGACTGGTGAGATCTGTATATACCTGCAGGTGGCGATCTCGCCGTCTACCGCTGTCGGCCCATCGATCTGG
TCTTCTAGCACATCGGTTCGCACAGTCTGCGTTCCAGATCATTTTCCGACGATGACTTCGATCCTCCTGGCTTTGGGTGCTTCCATGATCTGGCTGCTGC
CGGTCGCCCAACATATGGGTCGTCTCAAAATGCTTGTCGGTGTGTCATACTGCGGATGGGAGACCATCGGCTCCGTCGACTTCTCGATCGGATTATCTTC
CTCGATCGTCACATCCGTGCTAGCCTGTAGTACCAGATTCTACCACTCGGCGTACCGACGCGATCCTACGGTGATGAATCCTTGACGTCTTGGTACACTA
TCTCCTGACAGCCACATGCCTACCGAGGTATTAGCGAGTAGGCACCTCGTCCGGTCGCTGACATTCGTGATCTTCAGGTAACGCCTGCGTGCATGCCCTT
CAACCACGGTGGGAATTAATTGCTCTCCCCGAGTGATCCACAGCGTTTCCGATGGCTTGGGTCGTAATGGCATCTCGATGCTCTGTCGCGCGTCTATTAT
CTTGAGCCCGTCCAAACCGACTGGGCGAACGTATTCGCCATACAGCGGGTGTCGTCCGGACGACTGGATGCGGACCTCTTCGGGTAAGCATAGCGTCCCG
TCGGCCAAGTCCAAGCGAATCCCCGCTGGTACCATGAAATCCATACAGAAGATCGCGTCCTGGTCTGACATCTCGCCGACCCACACGTCGAAGAAGTACA
CCATGGCTCCATCCAAGGTAATCTTGATCTTGGTACGTCCCATCGTGATGTACACACCTTCTCCAATACCAACCCACTCTTATCGTTGACTTTTAACCAC
ATAGCACCCAACCTTACGAGCAAAGGCGGCGTCCAGAATGGTCACCTCGGCGCCGGAAATTAAGAGTAAGCTCGCAGTTTTGTTGTTGATCTTCCCTCCC
GTCTTGACTTGCTTGAACCACTTACTGGGTGCGTGGTAATTCCAGTATCTACGCATCTCTCCTGGCAGTAGATCAAGCGTCATAACGGTATCAACTCTTG
CGAACTCATCAAGCTCGCGAAGGCTTGCAACAACACCGGCACGTGTTCCATGAACATCACATGTATTGTCGCTCGGATTCTCCCGCTCACTAACTTTGGA
TCTCTTCTTGACGTATGCAAAGATGCAGAGCTTGGAACGGTCGGCTCGTCCTGGCTTCGAGCGCCCGTGTTTAACATCTTCTCGGCGCTTTCCGGCAGCA
CGCCGCCATGCTTGGCCGGGTTGTACCACTGACGGATCCAATTGTAAAACCCCTCCATCTGGCACTTACCAACCTGTGGATCTCGCCGCATCCGCGGCAC
ACGAAGAGACAACGAGCCGATGGGTGGTC