Description :
From Genome Similarity Track
Location :
Scaffold_331:13- 1559
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_331-abinit-gene-0.38Sodium/hydrogen exchanger

Sequence
1546 bases(100 bases per row)
CGGAGAaGCGCTGGGCGGGCGGCGAGCTCCTGGTCTGCGCGCTCATCCAGCTCGTGCTCGTGCACGTGGCGCACCGCATCGACCGCGCCAGTGCGCCACC
TCTCGTGTCCACGTCGTCCTGGGCCGTCTTCTTCGGGCTCGGCTGTGGTGCGCTGCTGgCCACCATGTCAGAGACGCGCGTGCACAGTGCAGGACTGGAC
CCGCAAGTCCTCTTCTTCGGTCTGCTTCCGCCCATCATTCTTGAGGCCGGCTTCAATACGCAGCGCAAGGGGTTCTTCTCCAACTTCTGGGCCATCTTGg
CCCTCGCGATTCTCGGCACcGTCGTCGCCACGTTCGTCACGGGTGGACTGCTTATATGGATGGGTGAACGAGGGTGGATCACGCAGTTTACAGATGCTGA
AGCGTTCCTCTACGGCgcccTCATCTCCGCGATTGACCCCGTGGCCACGCTGCTCGTGTTCAAGAAGAGCAAGGCCCCGTCCCTGTTGTTCAACCTTGTC
TTTGGTGAGAGCGTCCTCAACGATGCGGTCGGTACGTCGACAACACTCGTGACTGTGGATCGTTTGGATTCTCACACTTTCTGTTGTTGTAGCCATCGTG
ATCTTTACACTATtCcAGAAGTTCGTGTCGAGTGGCAACTCGGAGGTCACTGTACACACAGGCATTTCCATGGTCACGGATCTTACCATTATCGGTTTGG
GCTCTGTGGCTCTGGCTGCTGTGGTCTGCTACAGCTCCGCTTACTACTTGCGTCACTCGCACTCGTCGCTACGGGACCACGCCACGTATGAGATCTCCAT
CACTCTCCTCTCTGCGTATGCCAGCTACGTCGCGGCCGACTTGTGTGAGCTGAGTGGCTTGCTCGCCGTCTTCTTCAGCGGCGTCTTCATCCGCCACTAT
CACATGTACAACATCGCACCCACAACTGCCGAAGCCTTCAAGCATTTCCTCTCAACTGTCGCGTTCCTCGCAGAGAATTTCATCTACCTCTACCTCGGCA
TCAGTGTCATCGCTTACAATGGGTCTTTTGTATGGGACTGGGGCTTCATCTTCGCGTCCTTCGCCGCGTGCCTCGTTGCGCGTGCTTTGAATACGTTTCC
TCTCTGCTCGACAGCCAATCTATGGCGCTCTCCTGATCACCGTATCCCGTTCAAGTATATGGTCGTCATCTGGTTCTCGGGGCTACGTGGAGCTATTGCG
TTCGCTTTAGCTCTCAATGCTCGCTTCGAGGACACTGAGCACGCCGCCATTCTTCGAAGTTCGACACTCTTCACcGTGCTCTTCACTACCGTGCTCTTCG
GGGCCGGCACGGgCCCCTTGCTCCGCTTGTTGGCACTGGATAACGCTAGTGACCCCGACGAGCTAACTGTCGCCACGCCAATGAGCGTGTCTGGAACAGG
TGAATCGCAGCATCTACTCCCAAGTGTCAGATCTTtGagCCGCCGTCCTAGTCAGAGTGTACACGAGGCGTGGATCGAGTTAGACGAGAAGTACCTCAAG
CCTGTCTTCGGTGGAAACCCGCGTGCGGGACGTAGTGGATCGACGA