Description :
From Genome Similarity Track
Location :
Scaffold_1275:13- 1400
Transcript NameFunction/comments
Phyin_T30-4PITG_22133Putative uncharacterized protein

Sequence
1387 bases(100 bases per row)
TCTTCGAGATCCGTGTGGATGCCTCGGCTAGTCCCGCTAAGATTATCTACCTGAACAACGGCACTTGGGACGCCAAGTGGGAGACTGAGTTCGTGCCGGG
TACGTGGTACAACTTCGGCATCGGTATTTCGGCTGCCACGTCGGGCAACGGCTCTGTCCTCGAGTTCTACACCAGTGAAGGCGACAAGGAGCTCGCCCTT
GAGGCCACCCACGACGTCGTGACCGAGTTCCCCTCGACCTACGAGTTCCATTATGGTCTTTTGACCCTGTCCGACGATGGCAGTGAACCCAAGATGAATG
CCAAACAGGACATCGTGTCCTACAACGGTGTGTCGGTGGAGGCTGACGTTTCGACTTCTGCCACGGGCGATGCTGCGTCCAAGGCTTCCAAGACTACTGG
ATCCATTGGTGCTGAGTCCTCGTCCGATGTTTCCACGGAGACTACTGAGGCCCCGACCACGCAGAACGAGACCCCTGCCACCCAGAACGAGATTCCCGCC
ACCAAGACGGGCATCGTCAAGAGCTCAGATAGTGGCTGCGCCCGCAAATAAGTGCGCCTAATGTTATGTCTGTTGTGATTTCGCTGAAGTGATACAGACA
GTGACGGAGACGAGAAACGTAAAGCATCGGTCAGGAGATGGCCTTGTAAAAAGGGTTTATATCCCTCTGTTAGCTGTATCATAATGGGATAAATGTTCAA
TCCAAGTTTTGCAGTATTTTTGGATACAATCTAAAAAAATGACGGATAGATTTTCAATGGAAGTTATTATAGTTCATGTGATTTTAACAAGGTCACTGCA
ATATACTACTAGTACTTATTTGAGTATACAAGTATACAGTGTACGTGTACGTAGTACTGTACTAGTAATGTTTAATACTACGCAGTACTTCAGTAGTAGT
ACTACTGTAGTACTACTGCAGTACTACACCTTTGTCCGTCCAAACAGAGAATAATTTCAAGCAAAGTGGACAATTTGGTTTTTATAGTACAAATTTTAAC
TTTAGTAAAAGTAATCAACAAACAAACAGAGAAAGATCTCATCCAAAGCGAGACAAGGAAAGGCGATGACTGGAATCATTCGTGAAGGGGTGGTGAGGGT
GCGTTGGCGCCAAAATGCGCGCGAAAACCTCGCCTGAAGCAAACCATCGCCTGAAGCAGTTCACTTTTCAATTCACCTCTTCAGACGAATGCCCTTCCAA
CCACTCCTCCGCAAGCACTCCCCCGCTGAGAAGCTCCGTGTCCTAGCTGCCCATCGCGCGGGACGCGCTGACTGGCTTCAGGTGGCCGCCAATAACGGCA
TATCGCGTGCGGTGGCATACCGCACTGTAGCCACAGGACGCGTAGAAGACCTACCGCGCGGTGGAGCTCGTGGTAGAACTGTGAAGA