Description :
From Genome Similarity Track
Location :
Scaffold_102:13- 1245
Sequence
1232 bases(100 bases per row)
GGCTTGACTTGACACTGAAACACCAGAGAGGCTGCTCGGCGTGAGCTCTCGAATGTCATCGCCTGGACCGATGATCTTGAGGACGCAACTGACGCTGCAA
AACCTGAACTGAACGTGCGAATGGTCTTGATACCGTGAATAAGCAGGCAGGAACTGTATCCAACTACATTTAGGAGAGTTCTGTTTTAGTGCAGAGCTCG
TTACTGCACAAGTGATGGACTTGCCGTCCACAGGCGTTGCAAGGCGATGTTTTCTCGAGGTTTCCCCAGGCTGCTTTAGCGCACTTCATCGTGTCCTGGA
AGCTTGCTAAAAaagagggggggggcggaGAACCAACTGCGTGCGTCGTTCGaagatccagcgctggttgaagctcTCCCACGATAGTAGTTATATATTC
GAATATATTACTGACACTTCAGCAAGTGCACGACTATATCTATATCACTATCAGTGATATTGTCACTGCTATAGCTACTATTTTGAAaactactaccaaa
ccctggTTATTACTAATAACCAGTTCGACGTCAAAGCTTGATTCAGGTCGTTGTTAGTGACTCGTCGTTATTCTTGTAGTACAACAAACTAACCGCGAGT
ACTATCTCGAGTCTTGGGCAGATTTGGCTCTTGTCAATCAGGAAGTGAGACGTGTGGGGGAGGTGACGAAATGAAGTATGCCTGCAACTGGTGGAGTGTT
GAGCACTTGCATTAGTTGCGACCAGCAACTGCCTCTTCGAGATACTTTCCTACTACTCGCAGCTAGAATTCTCCAAATTGCACAGTTGGGCGTTGTGTGA
GGGCGGTTGACCACAAGCAAACTCATTACCCCCGAATGTACGTTGGCAACACAACGTGCAACACCTACGGTAACTACAggccactgctgccatcaGGCTA
CTATTTGGTTGGGAATTTCCTGCTGATTCAGCAGCATCGCAGGATTCTTTGTCTGCAACCGTCAGAGTCAGGCTcgtacttctccagcgtcCTCAGCGAA
CGTTGTTGTCCGCGTCATGATACAAATAATGCATCCCAGACTGGGATGCATTAATCGCGTACTGGGAATCCCAGTCAAATGGAGATATTCGCAACTATCA
TACTCGACAGTAGGTGGACTATGATGTTTTGAGCGTACATAGTGATCATCCACACAGGAGCCTGCACCGCTGCAGCGATGCGCAGTGATTTTGTTTGACA
TGTTCAGTCTCCCTGCACGACCACTTTCAACT