Description :
From Genome Similarity Track
Location :
Scaffold_2463:13- 1171
Transcript NameFunction/comments
Phyta_totarag14519hypothetical protein

Sequence
1158 bases(100 bases per row)
ggtcgatcttgattgatggaactagatcgaccaggaaatttctgcgTTCACTTCACCACAGCCGTTCCCTGCACGAGTGACAGCCGCACAACGGTATTCG
CTCGCTGCACTCTGGTCGTCATTCTCCAACTTCCCAGCtcgccaccacgtccacgccACCTCGTGCCAtgtcgcctgcagctcctaGCGCTCGGCGTTCT
GGCAGAGATCGCGCGTTCCCTGGTACGGCAACGTCGTCAGACACTACGTCTACCACCGCGTCTCCTTCGGCTGCGAATGTATCTCCGGCAACGTCGGCGT
CCACGATCGACCTCGACCCGGCTCCCGCCATTGACCTCGATCCCAATCATGGTGATCCTGATCCGGCCACAGGATGGTCTCCGGCGATGGAAGGCTTCCG
TCTGTTAGTCGATGCAGCTTTGCAGCCGCCGAGGAGCCCCCGACTACTGCTACCGCTGAAGATCGTCGCCCTGCTGACGACACGCCCTCGTGTCTTGAGT
GCGCTCGCCACGCGTCGGCTCTCACGGTGAACCTCGATTTTTCGCCTGCCAACCTCTCTGCCGTCTATGGTTCGCTTCAAGGCGTCTTGGCAGCTttgca
ggagatcgaggtcGCTGTACGTCGCGCGCATACCTCGTCTCTTCACCACGCTGGCGATCTTCACCGACAGATCGCGTCTgccaccgctgctgccgtccCA
TTCGTCCGCTATTGTCAAGATCGGTACAATTCCTTGTTAAGCGCGCTTCAAACGGCGCGCTCCCAACTTGAGGAGCGCAACTTTGCCGTGGATCGGCTGG
AGGACGCGATCAAATCAACCCTCACCTCCAACAAGGCGCACATCAAGTCTCAAGCAGCTTCCGCCTCGACTATctgtcatcttcagcgtcgGGTGGCAGC
ACTTGAGATCTTGACCACAAACCTGGAGGCTCAGCTTTCTGCCGTGACACTCCATCTCGATCTTGGttcgcctccacctcctggTCTCGCGTGtcgtctt
caagctcaagatcaagcgTTGTCCGATGCCCTTCGAGATCGTGACGCCGCGCGGCAGCGCTGCAAAGTACTGATGCAGTCGGAGAAGTCATTAGAGGACG
CCGTGGCTCAACTTCGCCGCCAGGTGGAGGCTCAAGATCGAAGAGTGACCCGCCTAAG