Description :
From Genome Similarity Track
Location :
Scaffold_164:12999- 14158
Sequence
1159 bases(100 bases per row)
AATTTCGTGGAAATTAGCTTCCCTCAATTCGTACAGGACTGAGGTGTATATGGCAAAAAATCTTTAATGAACCGGCTGTAGCATTTCAGGCTCCCTAAGA
AGGACTGCATCGACCGCAATGAAAGGGAAAGGGAATATTGATTAAGGACCCTAAATCCTTCGGGTCGGTCGGCTTCTATTCCTGATATTGACACTTGGTT
CCTGAGATACTGGACCTTGCGTCGTCCCCAAACACTCTCAGGTATGGTGATCGACAAATTCCACTGATCACATAATTCCAACACTCTGTTCACCTTTTGA
TAGAGGGACGTCCAGGATGACGCCAGGATCAGAATGTAATGACTATACGACCTCCGTCTTTAAACAGAAGGCCTTCGGTGCGGGTTTGCATCGCCGTCTG
TAAACACATCGACCGGTCGAGACACCTCATGATCACTTGACCTCTGCCGATCACCGATCGTGATATACCCATATAATTCGTTATCCACCATACGTTGATA
TATCTGCGGAGCGTTTTTCAACCCGAACGGCATGCGTAACCATTCATATAGACCCTAAGGCATAATTAAAGCGGAGATCTTTCGTGCTCTTTCTGTCATC
TCCACAACTCAGAATCCCTGGTCATTTCCAGTGAACAGTAGTATAGCGCATTTTCCAGATCTTGCAAAAAATCGTTGATTATGGACATGGGATATACCAC
AAGCCTCGTCAATTCATTAACTGTTAGGTGGTCAATACACAGTCGTATATCCACCCCATTCTTTTCCACGACCACGACGATTGGTGACGCCCATGGTAAA
GTAGAGGGACAAATTATTTTGGTCGCTAGTAACATTTTGATCAGGTCCGCCAACTTTTTGCGGGAATATGGGGCGACTGGACTTACTCGTTGTGCTATTG
GAGTTGCTCATTCAACATCTATGTCACAGATGATGCCTAGTGCGGTGAGTGGTAGGGCATTTAATTAACCCATCAGGAAGTGTCGTTTCTTCCAGATCAG
ACGACGTAATTCTTCTTGCTTCTTGGTTAATGGGACTCCCGGGTCGCCCATCGGTATGTCGTCAATTTTTACCTCATCTGGCCTCACATCCAATTCCGGT
AAGACTGCCATATGTTGTCCAATATCCTCTGCAAACAACACTCCACCCTCATGATGATA