Description :
From Genome Similarity Track
Location :
scaffold_3:129982- 133868
Transcript NameFunction/comments
Pl_112992hypothetical protein PHYSODRAFT_313783
Pl_112993hypothetical protein PHYSODRAFT_329631

Sequence
3886 bases(100 bases per row)
TCGTCTCAAAAGTGCGAGGTATCGCGTCGATCAAATTTTCGAGCGTGGCTGCTGGACTTTCAGTCGTCTCTGCTTTTGTCGGTATCATATCGATTGTATT
TTCGCTCACAGGTACTGGTGTTTCGGTTGTTTCTACTTGAATTGTGGCTGCTGGACTTTTGGGTGGCTCTGTGTTGGTTGGTTTGGTATCGATTGCATTA
TCGAGTGGGGGTAGTGTCGCTTTGATCGCCTTTGCTTTGGTGGATATGACATCGACCGCATTTTCATGAGGAGGTACTGGTAATTCGATCGTCTCTGTTT
TCTTTGATATAGGACTCATTCCATTAGCGAGTGGGGGTAATGATGTTTTGTTCACCTTTGGTTTCGTATAGATCACATTTTCGAGTACTGGGGTTTCCAC
CGTGGTAGGTATATCATCGATCGCAATCTCGAGCGTGGATGATGCTGGACTCGCAATTTCAGAATAACGTTCCATTTCAGCGCCACAACCCGCTTCCAGA
GTAGGCATAGTTTCCTGTTCACTTGTGAACTCAACTTCAACAGGCGAAGACTCCTCCATAGAGGTTGATTGCGAAAGTGATGGCTATACCTGCGCTGGTT
GACACCTGGATGGGATTCCTTGCACCAAAATACTCGAATGCCTGCTAAACGTGAATCTCAAAACAACTTACCAGTGAGTTTTAGACAAAGATAGCTGTAT
GATTATTTGGACGTGATCGCCCAATATATAGTGTACTAGCTTGAAGCGAGGACCTTTACACACAAACACCGACGGCTGACTTGAAAGCTGGTCTAGTAGT
AATCATAATACAGGTCCTGACAGTCGAGAAGCGCCTTGACGTTATCTCGAACATGCACCAGCCACGCGATCTGCTCGTCGAGGTGGACCAGCATTTCCTC
AAGTTGCGGGACCGGCACGGAAACTCGGGCGTACTCCACAATCTCAACCTTTTGGCCGCGGAAGGCACTGTTAACAAACGAGCGAGTTAGTTAAGCCGAA
CTCAATAAACTTCAAATTAAACAACGCACCAAACACAGCCGATGAACTCTTTCCTCGACGCACAGCCCTCGGGGATGTTGGTGATTGCCTTCTGAGTAGC
CATCAGACTAAAGGCCTCCACTAACTATTGACCAAGCAGTATACATAAGAGTTAGACTGAGGTCTAACCTTGTCATTCTAGCATTTAGCAACGCACCAAT
TCTCCTCGGTGGATGGAAAAATCCACAATGACCTCGGATGAAAGAGCGGGTTTGAAGCTCTGCACAACATGACGTAGCATCCATTCATTAGTGCATGACC
ATACATACTTCGTTATCACCAACAAGCACGTACATGGTCAACGTGAGAGCAGTACGGGAACCGGCGGCGACTGGGTAGCCGCAGGACATTAGCGGCGTTG
CGCAGTTCCTGGCAGATGCGGCCCAGACTCAGAAAGGTGCGCTGCACGATCTCCACGTACACTTCGACATCGTCGTTACTGGGCTGGTCGTTCAATAGGT
CGTTGCGTTGCACGTGCATGAATTCCTTAAGTGCCGCGAGTCTACCAACTTGGCTCTGCACGATGCCGTGGAACTCGAGGATCTGGTTCAACACGCAATA
TTGCTGCAGTCTGTGTCATCAACACACGATTAAAATCAGCAAGATCAGCAGATTTCTAGTTCAGTTAGTCGTACGTGCTGGTAATTGGTGCATTGCGCTG
GGCCTTGGTCAGCTTGAGCTCCACCTTGGTGAACACCACAAGGTGACCCTGTCATTAATTGACACGTGTAACATAACACATGTCAGTGTAGTCCGTATAT
AACCTAAATCAGTGCGACCACACATACTTCGACGCGGATATCGGCTTTGATGGCAGGTGACACAACACCACGGTCTGAACGAATGCGACCCCAGATGAAA
TCGATACGCTCTAGCTCGTGTGCCGCATAGTCAATGGCCGAGTTCACGTCCTTGAGCAGATAGTAGCGTGTCTCCCGCTTCTGCTCCACATTAAAGTCAG
CAGAGTACTGAAAAAAGTTAACTCTAGCCCTACCCACCCATGCGCTGAGCTCATCGGCTGCTTCTTGGCCACGTTGGCCTACAGAAGCTGCTTGAGTGAG
ACTGCTGGACATCTTGGTATAGCTTGTGCTCTGATAGACGTAAAGTCGGAATGGCAGACTCCGCAGCCCTGCCGTGGTGTCGTCCACGTTGAACCAGCAC
AGAAAGGACACTTTCGGGACAGGCACACGTACCCTCTTGATTCCTTACAACAATAATCCTGAAATAATCGATGGCTACATGTCGTTTTCAAGCGAGTTTA
TCCTCTAATAACAGATAATTCGCGGTCATCGCCTGAAATCAGCGAGAATGAAAGGCGATTTGGGTTCGTATGTGGTGGTGTGTCCATGCTTTCTCGCCAC
AAACTTGGCAATTTCTGCTGAGCTTGTCACAAATGTGCCAGCTGGAGGCGAGAAGCACCATCTTCTGTCTCAATTTTCCGGCTCTGATGCAATAGTGTTC
AACATCAGCAGCTCTGTTGTAGGCTAGTATACTTGGTAAAGTACATTGCGTTCTTGATTTGATGCAGCTTGTGTATCTGTCGTATGTTGAAGCTGACCGT
TGATGCCAAAGATACTTTTTCTCATCTTACTGTATTTATATCGCTTTCGGGGTGGCTACATTTTTGTGTACTTTCAGCTGCGAGTCGCAACGTGCAGCAA
GATGGCAGCACTAGCGCTGGATGTCGAACAAGACAAGACTCGCGATCTCTACAATGCACTGCGGACGGGTGATCATGGTGTCAGGTAAGAATGGCCTAGG
TAGTTGATGCCATGTGAGACGGGTCGCGCTGATTGTCGTTTGTCTGGTCAGCCTCGAGGCGCTAGCTCAGTCGCTCTACTTCCTGCAGAACGAGGAGTTC
ACACTCTTCGATGTGAAGAACGCATTTCGATCGTCCACTGGTGTGCCCCTATTTTTTAACTGTGTACTTGATATTTGGCATTGACCCAGTAGTCTCTGTT
CGATGTGGAGGGGCGAGCGAGCGCTTTTTGGCGTACCGAGAATTTCAAATCGCTCTGAGCAAGATCGCTCGTGTCAAGTACTACGGTAACAGTGACAGAA
CTGACGGGTATATTGAATCGTGTGCTTCACCGAAGCAACGCTATAGGCCGGCAGAGTTAGAGCTCTTGTGTTCGCTAGTTGATGAGCTAGTGACTGAACA
TCAAAACAACCAACTCGATACTCTGCAATGTCAGATGACTCGATGCAGCGCTATCGATACGCTTGAGCAGAAGTTGCCGTTATTAGTGCAAAGCTTTCAA
CTCTATGGTTCGCAAAATCGCTTGTCAACGAACCTTGCGACATCTATGCTGTCGACCATCACGCTGGACGGGTTTGTCGACTTTCTTAATGCGTACTTTG
AGTACGAAGAGTTCTTCTCATTTGGCGATCTCTCGCGTGTCAGTATTTACTGTTTTACTAAGCTTGGCTAGGTTGGAGTAGTGACACTGATGCTTGTATG
ACCGCCAGATGTCAACAGAAGTTCTTTTAGGGTTTGCCAGAGTAGCAAGTAAGGCAGAAACAAAGGGCAGCAAGGATGTACCAGCTTCCATTGAAGGTGA
ATTGAATTTTGCACAGTTTCTGGAGCTGTTTTGCCGCGTGGCTTCTGCATTTCATCACAAGCTTCTAGCCCGAGAGGGTGCTCAGCTCAGGCGAGCCGTC
GAGTCTTGCCGCCTCGAGTTCAGCCTCGAGGTGTTATTGGATCGCATGAAAATCACACTCATCCCGAACAATGACTCGCTACCGCGATCTACCCAACTAG
AGCAAGGTGGTTCTGTCATTGTGTCAGACATCGGAGATCTTACAGTCTCGTCGCCACGAAGTGACGAGGTGCCTTCCATGGTACTA