Description :
From Genome Similarity Track
Location :
Scaffold_6:129972- 131057
Transcript NameFunction/comments
g811.t1hypothetical protein

Sequence
1085 bases(100 bases per row)
TGTGTACCACATGACTATGAGCTTCGAACGCAAGTTTTATCTGAGTTCCATGATGGTGCAGCACACCCAGGCGTACCACGAACGCTAGCTCGAGTGAAAC
AATGGTACTATTGGAAGGAGTTGGAGACTGATGTCAACGATTACGTAAGAAGCTGCCTGACGTGCAACAAATTCAAGGTGTCGAGCCTCAAGAAGAAAGG
GAAGCTGATACCTCTCGAAATCCCATCGGAATGCTGGGAACACGTGGGCGTCGATTACATCACTGGTCTACCAGAGTCAAACGGTTTTGATTGCATCCAA
GTTGCAGTTGACCTCCTTTCGAAGCGTGCTAAGTATGCACCCATGCACTCTACAGCAACTGCAGCCGACTGTGCACGAATCTTCTTTGAGTCAGTTGTAC
GCCACCATGGCTTGCCTCAAGTCATTGTGAGCGACCGTGACTCTCGATTTACAGCAGCTTTTTGGCAAGAGCTAATGAAGATCATGGGAGTAAAATTACG
AATGACTACGGCACACCGTGCACAAGCGGACGGTCAAGTGGAGAGGCAAAATCGAGTTTTGGAAGACTCCCTTCGTTGCATGACTAGTGTTCATGGCTCA
GACTGGTCAGAATTGTTAGGCACGATTGAATTCGCGCACGCAACGCTGGTGAGTAGATCAACGGGTTTGACACCATTCGAGATTGACTGTGGTCGTGTTG
CACGGCACCCCGGAGCTGTGAATTCTGATGATACTGTTCGCCAAGTACGTACCAAGGCAGAATTTGCTCGGCAGTTTGCTGAGCGCCGACGTGTGATTGT
TGAACGCGCACAGCAAGCTCTTCTTGACGCAAAACAAAAACAGAAGCAGTATTACGACAAGCGTCGGTCGGAACCAGACTTCAAAGCTGGTGATCAGGTA
CTGCTGAAAACCGAGCATCTATCGTTCAAGCATGTTTCTCAGAACACTGAGCTAACTAAAGCAAAGTTGGCAGCACGATTGGTGGGACCTTTTGCCATCG
AGTACATGGTGAATGAAAACGTGGCTAGGCTCAAATTACCAAAGCGATTTCGACGCATTCATCCTTCCTTCAATGTCGACCTCCT