Description :
From Genome Similarity Track
Location :
Scaffold_7:129959- 155690
Transcript NameFunction/comments
Phymu_g560conserved hypothetical protein
Phymu_g561hypothetical protein PHYSODRAFT_466632
Phymu_g562conserved hypothetical protein
Phymu_g563conserved hypothetical protein
Phymu_g564hypothetical protein PHYSODRAFT_470700
Phymu_g565hypothetical protein PHYSODRAFT_477864
Phymu_g566hypothetical protein PHYSODRAFT_551952
Phymu_g567vesicle coat complex COPII subunit SEC13
Phymu_g568hypothetical protein
Phymu_g569hypothetical protein PHYSODRAFT_309136
Phymu_g570hypothetical protein PHYSODRAFT_353495
Phymu_g571conserved hypothetical protein
Phymu_g572hypothetical protein PHYSODRAFT_437295

Sequence
25731 bases(100 bases per row)
AAGACATGGCAGGTCGTGAAATTGTTGAGTTGATTTGGCACTGCCGACGAAACACTGCCCTCATGAGCCCGTTGCGGCGTGCAGCATTCAACATTTCGAG
CAATTTACTGTGTACTTAAAGTACAATAGCGCCTTTGTTTACAGCGAAGTTGCAACCTCGTGGAGCTCGTCATTGCAGCACGCCCTCTGCGCAGTGGATC
TTTTGCAACAACCACGACGCGCGCTACCGAAGAGGAGTGGCGATCCTGTAAGGTTGTTACAGCGGTGCAACCTTCATCACTGTGAGCTAAAGACGTCGCA
CAGTAAAAGCCAACATGTTTTTGCGGAACTCAACTTGTTGAGACCGGCCAAATCGACGCACATTCGTTATGTACAGGTGATAAAACATCCACCCACTATT
TGATTTTACATTTCATATACATCACAAATAACAGAATTATAATATGGTACAGGTTACGTTTTGGCTATTTCTTCCCACCTTTTAGTGCACCTCTTCACCA
TACGCTATGCCCATTTTCGATGATCCACTAGTGCCCCCCATGCTCAGCCGACTGCTTCAcctggcggcgctgctgacCTGCCTCAGCCGCGTTGGCGCGA
CTGGCGATGCCTTGCAACCCACAGCTGTGCGTCTGGTGACCATCCACCCGCAcaacgccagcgccttcacggAGGGACTCGTGTTTGATGATGGCGCCCT
TATTGAATCTACAGGCCTCCATGGGGAGTCCTTCATTCGCAAGTACAAACTGTCGGACCTCAAGCCCGATTTCTTTAAGGCGGGCGCTGTACAGTCGGTG
CCTTTTCTGCAGGAGTTCCGCTTCGACTCCGCCATCTTCGGAGAGGGCGTGACCGTTTTGGGCGACAAGCTGTTCGCGCTGACGTACAAGgcggagcagg
tgctggcgctgtcACGACATGACTTCCAACTGGTCGGTCAGTTTCCCCTCACGACATCCACCAAGGAGGGCTGGGGACTCACGACAGACGGAGAGTTCCT
CATTGCCAGCGACGGCTCTGCCAACGTGCAGTTCTTCGATCCGCACGACGATTTCAAGCTGCATCACAGTATCACCGTGCGGAAAGATGGCAAGGCTGTG
ACCAACGTGAACGAGCTAGAGTACGTGGAGGGAGAGCTGTTGGCCAACGTGTGGTTCGAGGACCATATCCTGCGGATTGATATCGAGACGGGGGACGTAT
TGGAACAGATCGACCTGGACTGGATACCCAACATGGTGCCCAACCTCCACACTGAGGCCATGAAGATGTCGCCCTATCAGCAGGACGCCGTGATGAATGG
CATTGCCTACGATCCGGTGACACGTCACGTATTTGTGACCGGCAAGCTCTGGGACTCCATGTTTGAACTTGAGCTGTCGTATCTGAACTCGCACACCCGT
CATATTGTCCCCTAGATCGTGGATCTTGttgctggctcaagaagaagttaAAAAGCAAACCGTGTATAAACTCCACTTATATAAAAGGATACTGCGACTA
CGATCAAAGACAGGGATACGTACGCCCACTTTCGTTCAGCAGGGATATCGACGTGGAAAACATGGAGGAAGCTGCTTAGGCGAACTTCTCCGAgtggaag
tcgaagatgGTGCCTTCAGCCTTCGAGGACGAGTACTTCTTGCACACGTTGCTCAAcacttcttccagttcgtgAGGTCcacagcagaagacgccgatCT
CCTCACCGGGGTGCTTAGCTCTGGCCTCCGAGAAGACCTTGTCCCAATCGGGACGGCCGAAGTGCGTGAGTTGCTTCGTGTCCATTCCGGATACGAAATC
CTTTCCTGTTTGTTCATGTACAAACTCCTGGAACATCTTGAGCTGCGACGTGTTCTCCTcgccaccaagcaccacCGTACTCAAGTATTGGTGGGTCTCG
ATCACGTTGTCACGATCCATTTCAGCAATCTGCTTCATGGTGCCCTCGAACCAGCTTAACGATTCCTGCCCACGGGTCACCCAATGGAAGCAGAGCTTCT
GAATCTGGAAAGAACTCGGGTGACGCACATGGTTGCAATTCAAGCAACGGTTGTCCTCCCAAAGGTGAACAACATCCTTCAAGATCGACGCAAACGGGGT
CACACCAATGCCGCCGCCAATGCAAATCACGGTCTTATAGCGATGATAATCCTGAGTCGGAGCGCCAACCGGGCCGTCCAAGTACACATCGGGGTACTGC
AAATTGCACGCGTGACAGTCCGCAATGACTCGGGCAATGGCATCCGTCCAGTCACCACATACACGGATGTGAATACTGATGTAATTGTCACCAGGAGCTG
AGGAAATCGTGAACGGGTGCCACTCGTGGGAAGAAATCTGTGGGCAGTTAAGATACAGGTACATTCCGGGTCTGTAGACGAATCGACGGGGTTTTTCAAT
GAACAACGCAACGGTGCCATCAAGTTCCATGGCTTCCATGATGCGAACGGGAGCAGCAAACATCTTGGCATATCGGAAGCGACGTTCAATCAGGTAGATG
AGGAACGGAGGAGTGATCCAGATGTACGATGAGCAACGAGCTAGCCACGACGTAGCTCCGTGGAACGCAAGCACGATCAAGAAGGGTCCGAAGAGCATGT
GCGAGTACCAGAAGAGGTTGAACTTGCCCTGGCGGAACTTGGGGATCGCAGCAAGAGGGAACGAAATGCAAGTGATCACCAAAAGGATCACACCCGTCCA
GACCGGGAGGGCCTGTAGCATCGTCGTGAACGGAGGACGTTCACCGTTCACGAAGGTTGAAACGTGTCGAGTCACGAAGATTGAGCGTTTAACTTCGTCC
GGGGTGGCGATCAGATACAGGTAGATCtcgttgaagacgtgggCGATGGTGTGGATGAGACCAGCGATCAGCAGGACGCTGCCCGAGATCTTGTGGAAGG
CGATGTGGTCGTCGAACGGGATGATGCGCCATAAAAACTTGCTTCGTTTCATCACTTGAGTGATCGAGCGACACATCGGAAGTAGAACGAAGACACAGTT
CAGCATGGCAACCTGCGCGTTGGCACGGGCAATACGAAGACCCCAACCGATCGCTGGGTCCACCTCGTACATGAACCACTTGACCCAGAAGGCGATgttg
ttgacgatgaagtagaagaagagccACCAAATACGGAGCTTATTGTCGCTGTACCACTGGCCAAACTTGCTCTTGGGGCGAATGGGGGCGGAGTACACGG
GTTTCGCCTCCTCGAGATGGTACGAGTCTGTCACGTACGGCTCGAATACCCCACAGAACTGTTCGAACGTCATGGCGTCATTCTGAACACGAGCTTTTCG
GAACATGAGCTTCGCCACCGTTTTGAATTCCATGCCCACCACATCGATCTTcgcactggagaagttggACTCCAGCAACTGGACAACCTGCTCCTCAACC
ACATACCCCGTGTTATCTGGGTCTAAAGtgtcgaagatgaagcgtAGTTTCTCGTGAGCGTTCACTCCGAGTTTCATCACAGCGTCAATCAGGATGGCAT
TGCCATCGACCGTGCCGGTGCTGGTAGCGTAGCCGTCGAATTCATTGCCGTCCACTTCAAAAGCCTGTGAGAAGGTCTCTCGTtcgatgtagccattgtt
GTCCGTGAAATTGCCCATAGCGTCAcgaagcgcttcgagcttctccatgggTGTGAACGCTTTCTCGTCCATACTCATGGCCACGTTATACTTCTGCTCG
AAGTTGCAGTCGCCGGGGATTGGAACGGTCACGACGTCACTCCCGGGCGGAGGGCCGTACATATCGTCCTTGCCTGCTGGTGGCGCAACGCGGCATTTCT
TCCGGGCTGAATTCGACGTCGCTGACATACCCGAGACCTGAGAGGCTGATAAACTTTGACGAACCGTGTTCGAGCGCATCATGGCGTCCACATTGGCTCG
ACGGCGACGGGAGCGGCGGTTATGGCTCCTGCAGTTGCCCACTACGTGGGTCGAAGTCGAGTTCATCGACATGAACTGGTTGCTGTCCATGAAATTGGCC
GTTGCCGGCTTTCGGAGCGGCGGGTTCTGGTTCATGTTGATCATTGTCGACATCATTGGAGCCGTTTTATCACCGAAGCGAGGGGCATTGGGCGACGGCG
TGGAGACGTCAATGAGCGCCTGCGTCTTGGCTGGGGTGATTTTTAGGTCGTCTTTGGGCTTACCACGCCCAGGTTCTTTCCGAGTACGATCCATGCTTTG
AAGACGCACTGCAAGAAGCAAAATGGAGAATGAAAGCGGTGGGATGCCGTCGAACCGAAGTCGGCACCACTTTGTCGCCATACCAGCGATGTTTGCCGAA
CGGGACGGCGATGGTGAAGGGAAGGTGGCGGTTTGCACGCATGTTCTGTATGTAATTTCGGTCAACTAGAAACGCGCGGTACGGCTATCCTCCATGCAGT
GCCAACATTGGGCTCAACAATGGTGGTGGGTCTGCGCTTCGGGAACATATCGATCCTCCACCTGCGTTTTACACGGACACGCCCAAGCACTCCACATTTT
ATTGATCGAGTACACGTATGTTGTTGCACTAGGCCTTTTGCGATAAATAAAATACAGATCATAAGCTTATGTGCTTTTTGCACTGCGAAACTTTGCACAC
ACTAAACTGGCAGTTACCTATCCTGCACGGCAGAAATCTGCAGCTAAAGCACCGCGACAAGCTGCACCCGCGGTATCAATTGCTCAATTTTAATCATGCA
GGACGCCCTCCGTTTTGCCTCAAACTTTTGATCATGACAACAAAGAGGTCTGGCTCGCTTTCTCGGTGAGCAACGATGGGCGATCTGGGGATTGTCAAAT
GCCGCGGAGCCTTCGGGTGCGTAATTCGATTGCTTCGACACTATGTCAACTGCAACGGCGACTTTGGTCGCGAATACAGCACAATTTGCGTTAAACTACA
GAAACACGCAGGGTCCAGGATCAGCCGCTGCCTTTCCCTAGGCACAGCCGAAGATGCCCATGTAAAGAAGTCTGAACGCGTTTCTAGTCGCGGTCGTTTA
GCGTTTTGGCTCAGTGCACGGTGCACTGCAATGCAGTGACTGCACCATCAGGAAAGGTGGCCGTCGCGCGAGCTACAAGACCGATTTGTGTCGCTCTGCT
TTGCCGTTGACGAGTTCCCAGACGCTGCATTCGGGTACAGCGTCGTCTATTGATGATGAACCAACCAACGGACTCCCTGTGCGACGCAATGTACAGCTGG
GACAGGGGCAACCGACCAGTGTATCCTGGGATCATTTCGGTGCGCTTGAAGCGTGGTGCTTGATTGCAAAAACAGCGGCACTGCATCCAGAGGATTTTTA
ATGTGGAAATTACTCCTTCAAACTACCCAAAGTAGAAGTTGCTGTGACgctgttacatgtactgcaatTCGTCGACAAGTGCAGAGGCAAATAAACCGAC
GCTTACGGGAAGCTATACGCTACTTCGACGTACTGTCGAGTTCCTTCCCACTGTTTTCATTTCACTGCCAACGCTGCTTATCTAGCTATTCTCGAATCCG
TCACGTTAAAAGTTTAGATTAATTGCATTTCAAACATCAAGCAAGCTTACTTTAAAGGGGCTGCGGCTATTttgtcgagctgttggcaAGAATTTCGTGC
GGTCAGAAGACCGAGAACGAGGTGGTAACCAGAATCCATCGAGTTGCTGATGTACTGCGTTGTGAGAAGGAGGCATTTGATGGTCGGTATCGTACCAAGC
TCCTGGCGCTACGCTGCTATCCGTACAGGATGACACGCCTGGATCAAAATTGCTGGTCACCTGTTCACTACTGCATGCGAAACtttgctcttcctcgcct
tcttcttcttcctcttcttgaagGGTCAGTTCGTGAATTGTAAGCGCTTGCTCTTCGATCTtctttttcagcttctgTCGCTCTAGCTGCAAGGTGTTTA
CTTCTCGCATCAGTTCGCTTTCGTTGTCTCCCTTCCAAGTTATTTTTTCATCTTGAAATTTGGCCTTCAGTCGATTTACTTCCTCTCGTAAGGCCTCACA
CTCTTGCCGTAAGCTACTAACAAGGCTAGCGTGCTCGGACAAGACGAAATCAGTTGCTGGGCCTGTGGATAAATCACGATTTGGTGACTCATTCAGTTTT
GACGGCGAAAGGTTGGTCCCGTTAGTCTTCACTTGCAACAAGTCATCGATAGTGTGAGCCTGTTCCTACAGGTGATCATAATATAGTGAGTTATCTCCGA
TAGTTTccttgcagcagcatcagcctTCTTTGACTTACCTCAATTAGCATGTTCGCACTCAGCTGCGCCTGTACAATTTCGTTCCAGTGCTTTGATTTTT
CTTGCTTTAACACTTCGTATTGAGCGACGAACTCTTCGTATCGACGCGTAAGCTGTTCGTGATCTTGAGTGATAGATTGCTTATCCGCTTCCAGGCTACG
GAGTTGCTCAGTCAAGCTTTGGCGCTGAACAAATGTTGCACAGTTAGATTCGTCGAGTTTTCGCTTGATAAAACGAAGCATACCTCTTCcagacgagctg
cttcaagctcttGAAGTTTCTTGCTTTGGTCTGCTGTCTGTTCAAATACGTGACCACCATATCGTTGACTTCTTTTGTCCAGCATACGCATTCCAATATT
CAGCGTTCTTACCACCGCAGTCAAGCTGGTCAAATTCTCGACCAGGTCCTGCATTGTTTTCTGTGTCACTTCCATCTGCTGAATCTCTTCCTCTCGTTTT
GCACTCGTTTCTCGCACCttcgcttgagcttcctTCAACATACTTGACACTCTCTGTTCCTTTTCCTGAAGTTCTTGGTGCTGGTTAGTTACTGACTTGC
ATTTCCCCTGTAGCACTTCGCATTTTTCGACAGCAGCCTGTAACTCTTTGCATGTATCCAAGTACTTGGTGTTCATTTCTTGGAAGCGATCCCAGCGCTC
AAGCTCCAAGTTCTTGGTGACTTCAAGCCGCGTCTGCTCACGAACGGCATCCAACTTAATCTGATCGTcttgttgcttctgctcAGGGGTTTTTAGACAC
TGGGAGCACGTCACGCTCATctttttgtgcttcttctcgattTCCCAGCACTCCTGCTCCTTAGCCTTCACTATTTGCTCATGTCGTGTCTTCATTTGCA
TCATGGCCTGGTAAAGCTGCTCGCTTTGCTGTTCGATGCACGTACGCGAGCGAAATAAACCATTGTAATCTTCTTGCAGCATCATTAGTTGCTCCTTGGA
GTGCTGGTGATTCCGAAGGACCTCCCGCCATTTATCCTTCATTTGCCGTACCATCAGCGCGTGCTCAGCTTTGATCTCACTTTTCGCatgcagcgcttct
tgcaACGCCGTTGATAAATCTGCAACCTTCCGCTTGTAAACGGTGACTTCACCTCCCATTTTTTCTTTTAACTGGAAGCTCGAGCGCTCGCGATATCGtg
cgtcttgcagctccttgtcgacaagctgcagtcgcaTCTTGCACTTTTGGAGCTCGTCCGCCATTGGGAGGTGCAGATTTTGCCATTCTTTCCGCTCCGT
TTCCAACTTGCCCCTCAAGTGCTCAACTCTAGCGCGTAATGCCTGACGCTCCTCTTGAGTAGATCGGACACTGGACGCAGACTCGTTTTTTATCAACTCG
ACCGTTTCCTCATGTTTTTTCTCCACTGtacgcagcttctcgttcagcCTGGAGAGCTTCGTTTGATCCTCTTGACGCTGATCTAGTGCGGTCTCAAGCA
GTGAGCTTGTGTGTGTAAATTGCTCATGGAATTTAGTGCGGTCGGCTTCTACAGTTGCCATTGCTGTTTGCAGCGTAGCGAtctcgcgcttgagctggAT
CGTATGAGCGCTcgctgcagccgtcgcacGAGTTGCAACCTggtccttcttcaccaactgCTGTCGTAACGTCTCAAGGTCACGTAGGAGCGTCAGTCGC
TCCTGCGTAGCAGAACAAATGGCAAATAACATTtaagatggctacaaaacACTTCAATTTGATATCCGATAGCCGTACCTTGTCGAAACAACGTTGAGCA
TCCTTCAAGGACAGTGTAGCGGCCGCGACCATGGCTTCCTTGGCCATGTTTCAGCGGAGGAGGTGGCACCTAGCCACGCTAAGTACAAGCTAaagcagtt
gcagcaccaACTTCCCGTGCACTTTATAAATACATTGCCATGTTCAAATTGGTACGTATGACGTCTGAAGAAACGAATATATTTTTATATTCCAAATGAG
GGGTATTCGAAGACTTTTGATTACTACAAAGGGGATTGCAGCGCCGAAGTATTGCTGCGTCAACGAtggcgctgcgtctgcgccAACTGCAGGTGGTGCA
CCGCCATGGAGACCGCACCCCGTTGACTAACATCTTCAAAGGGGCTGCCAATGCGCGttacgaggaggaggaggcgctaCTATGGGGAAGGCATCTACCG
GGGCCGACGCAACTTGCGCAACTCCGCTCCAAGTTCAGTGTGCACATGGGCGGTGAGCCTCAGCCTCAGAGCtccttccagcagcgcccGTTTGGGTACT
TGACAACTCGAGGCATTGAACAGATGACTGAACGTGGTGATCGACTTGTAAGATACAAATTGCTGCCTCGAAAGATTTGAAGTGAACTGATGGACTTGAT
GTGGTCGTTGACAGCGAGGATTCTgtgagaaggaggagctgcagctagATGAAGTGACTCCAGAGCAGGTGCAGATCTTCAGCAACGCGTACACGCGCAC
CCAACTCAGTGTGCAAGCGCTGCTGGATGGTATGCTACGCGACCAGCCCCAGTTGAGCCCTCCAGTGAGCGTTCTTCCTCCGGAAAAGGATATCATCAAC
AGTGCGTTTTTGCGTGGTTCTTCCTCAAACGTAATAGTGAGCTGATGCTGTTTGTACATGCATGTAGCTTATCCTCTCTTCCCGGAGATCATGCAGATGA
AGGCAGAATTGGAAAGAGACAACGCGGAGTTCGCGGCGCGAGAACACGAATTGATGCCGGTCAAAGAGGAGTTGAGCAAGCTGTTTCCGGCTGTAGCCTC
GGGCCAGGTCCCTTTCACCTGGTTAACCGCTGCCGACTACTTCGTCTGCCGTCGTGCTCATCAGGCCCCGTACATTCCTGGTACAGAAGTGCACGGTGAA
GCCACGGAAAAACACCTCGGCTTCCGTTTCCACCAGGTAATAACATGTTTTCTTGGCAGTCATCTTGGTAGTGGTGGGGGCTGACAAAGTGCTGTGATTC
CTTCAGTTTTACTCGCACCGGACGATCTTGAAGCTTGTAGCCGGACGCTTGATGCACAACGTGCTACGTGAGGTGGGTCCATTTTGCGTTATTGTTGCAC
TTTGAGCAGGTGACTGACGTCCTATGCGTTCCATTGCAGATGCAAAAAGCTCTCTGGGACCACACCGaaagcaagaagatcgtAATTTACAGTGGGCACG
AtgtgtcgctgctgtctgttCTCCGTACCATGGACGCTGAAATTGCAAATGACATCAGCTTTTGGCCCGAGTATTCGTCTGCCATCgcactggagctact
ggaagACGAGAACGGGAAATTCTTCGTTCGTGTTCGACTAAATGGCGAAATCCTCGCTATAGGTGAAAGCACAGACGGCTTCTGCTCTCTTGATCGCTTC
CGTGATATGGTGTCGGACCATACAGGTTACCTGTAACTTCCCTTCAGAACAAATCTGGAAGCTCATCAGCCGAACCAAAATGGCAGTGTGCACAGCAAAA
ATAGACCTTTGTTTCTACAGTGGAGCAGTTaagccagcagctcggccATTTGCAGGGCACGCTTGTAGCGTCTCCTGGCCAGCTTAATACTGAGCAACTT
TTCTTTTTCCTCAGCCGctgcctcttcctcctcttttGCTGGAACACCAACGTCAATGATTTCTTGCGCCGACTCCATCACACgctgtaaaaaaaaaaaa
aaaacttgtCAATAACTGCCATGCCTTACAAATCCCAAATAGTTAACGAACCTGGCGTGCAGCACCCTGGATACCATTGAGATACTCTAGTACAACGGAG
AACATGGATTTCGACACAACATCAGCCTCGTACATCCAGCGGAGAATCCATTGCTGTTTGATTTTCTGCATCACCACAACGCAATACACACGCAAACAAA
TAAGTGACAGCCCGACAACAGATCAAACGATCAGTTCAACGTACCTTGAACTTCCAAGGCAACTCATCGTCGTTCTTGGGCTCGTCACGCTTCTGCCATT
GCTCCAGGTAGTATTTGGCCTGCTGAATCATCTCCGGAGAGCGGTCTGCCTTGCCGCCAccttccttctcttcctctgcgTTCTTTTTCTTGAACACACG
CGCGCGTTTCTTGGGCACCACCTTCTCTCCATCATCGTCGAATTTTACATGCGTCTTGGctgtctccttcttggtcttgacggccttcagcttgccgcgc
tgcttcttggacggCTTGGTGGCAGCCATGTCTTCGCCAAATACGGCGTATCGCCAACCAAATTATGTCGACCATCAAAACAAAACGAAATTGCAATGAT
TGGTGGAATCTTATTTTACGAGCTTTTGATTGGTGGGTATTTATACCGTAAATAAACCCGCGCGGAATTGAGCTCGCGCCAAAAATCTCGACAATGCGCA
TGACCCCATCGCTGTAGACGCATCAGttctcttcttgctggcaaCAGGCACCGCTACTGTAGAGACCCATCGCTTGATGCGTATAGTTGTATCGTAGAGT
GCTAGTATCGAGAGTGCGGATATGTGCATTAATCGCAAACGCCCTCGCACTGAGCAGTTGCAGAGTCCACCTCCAacattccagcagctcgacgacCAAC
TGAAGCGCGTCAAGACAGATTCGCCGACGTCAGTGGACCACGAGGGGGTCACAGACAATCAGGAACCTgacaaggaggaagcggcgACGGCAGCGCACCG
CGATGAAATGGTAGCAGCCATTCTGACGATCACGTCGGCCTTGGGGCTCTCTCGAGAGACTCTGCACCTGTGTATCGGGTTGTTGGACCGTtatctgcag
cttcagagcGTTACGGTGTTCAAACTCGAAGCTCTGAGTATTTCGTAAGCGTGCTTTAAACCGACAGAGGTTATGAAAAACAATGTGCTGATGCAATCGT
GATTGCAAAATGTAGGTGTTTGTGGATCGCTGTCAAGTTTATCGAGACGCCTACAACTATTTTCGACAAGAGCATCAAAGAGATTCTGCAGCGACGGAGA
CACTCTAGCAACGTAAGTGTGAAAAGGCTTCCTTTTCGCATGATATAAGTACTAATGGCTGTGTCAATTTTTTTTACAGTGGACATGGAACGAGATTCTC
GACTTCGAGCTCAACGTCCTGCAACTTCTCAACTTTCGCATTATGGCACCTACAATTCTGGAATTGCTTCAGAAAAGAATGTTTGCTGAAGTCGACAATG
AGAACCAGAAGCACGACATTGATGGCttgcagttccagcagcaccagctaGCGCTGTATTTTGCTGATCTCCTGCTACTGAAGGCACGAGCTAACCAATT
CCCAAAGGAACTCCTCGTCGACGCAATATGGTTTGTCGTATCGGGCAACAAGATCGCGGATGTAAAGCCACCACTGCTAGAGCCCGTCGTACAGCTCTAC
CTTGCGCACCGTGACAATATTAACCCGAGTCACGCTGTTTTCAAGCCTTGGTTTGCGCTGCGCTGCCGCTATGGCGCCTTCCTGCCTGCTCCATGGCAAG
TCCCCTACGATCCGTCCTGTGTTTGCCGCGTCTGCGAGcacgcacaagaagaactcgcATCCTGATGTGTGATGGCTCCTTCACAACACTTTTACTGGCT
CACCCAGTACAAACTCAGTAGAGCTAATAGATGTACAATATCAAATCCGATCTCACGTAACCAGCGTTGCACATACTTCAAGTAGTTCAGTACTATGTAG
GTCAAGTCGACAATTCCAAAAAACACGAATGCGAGCTACCATTTGGCCCTCCACAGGCGATCCCATCTCCTAGCTGTATCTGCACGTTGCCGTCTCTAAT
GTGACCGACAGACGGCGTCTGTCATCGGTGCAACTGAGCAAGCGGTAAGTCTCGTGGCGCCTACAGGAAGTGCGTCTTGCGAAGATCCTGGTACTTCTTG
TACccggcagcgacgactcCGGCAATGATGAACACGATAATGAAGAACGGAGTCTTCCAGCTACTGGACTTGGCGGCCGTTTCTTTCACGGTTTCTTCAA
GCTGTGTGTCCACCTGATCGCGGATAGCATTCACTGTACTGTGCACACGCTCAACCACCTTTCCGTTTGCCCAAGCCTCCAGCTCAGCAATACGCTTCTC
ATCCTCCGTAccctgctgcttcagcttctggatcGTGTTCTCCGTAGACTCCTTCAGAGCAGTGAACTGGTACTCGAAGTCTTCAAGCAGCTGAGCGTAC
TTCCGCTTGACCAACTTCATCTTGTCATCGTTGTTTCCCTTGCTGAGTGTAGCTTCGAGGTTCTTGTCCACCGCATTGCGTtgcttctcgtcttcttggg
cCGCGAGCGAATCAATCACGTCACTATAAGACATCATAAAGTAAGTAAATAGTCTCGCCACCCCCACAAAAGCCAGAACCGAAAACTTACTCGTAGACGT
TGAAAGCGATGACATCGTGGTTGTCGGCCAGACCACCCGTCGAGGCCGAAATACCGATGTACGCGTCGTTCAGCCAGTCATCACCGATGTTCAGACGCTG
GGTGTAACACTTGACCCAGTTGCCCGAGGCGTCGGCGTCAATCAGGATCGTAAACTGCTGGTCCGCCTGCGTGTACGTGATCTTGGCACGCGACATATTG
AGCGACGGACTGAAGGCGGCGTTCTTCTCATGGTAGCGGATGCCGGGGGCCATGCAGCccaccttctccatgtcATTGAGCTGGTCAAGCGTCTTAGTGC
CATCGTTTTCAAAGAATGTCACATCCTTGTGGCCACCGCTGTGCTCCTGGTTAATGAACGtgtcgaacacgacgccGATGCCCTTAAATTCACCGATGAA
GCCGTGGTTGTCACCCTGCACATACTGACTGGTAGTGAGCCAGAGCGCCAGGCCGTCGCCGAACCAGGCCTTAGCCTGACCACTGATACGGAACGTGAAC
ACGGCAGCGAACTCCTTAGCTGCCAGTTTTTGCTTTCCCCATATGTGGCCACGCTTGCTCTGTCGGTCAGGCGTTAGACGAGCGAAGTGGCGGTTCACGG
CCGTGTCGCCGCCATAGATATAATTGTCTCCGATCTGGCGTAGTCCTTCGCCGTCAATGTTGTCGAAAGGTTTATCAAAGGAAACGTGGTCCAGACGCTT
CGCAATGACAGGAGAAGACTGCAGCAAGGCTAGCAGCGCTGCCACGCACACCAGCAACACGCGGGATACGCTCATGGTCGAGATGTGGACACGCGGAatg
aaggagctggctgACTCTGCCAGGTCCGTCGGACTGTACGATTTGCTACGTGGCGATAATCCGGACCAGACCGAAGACAAAGTACTGAAAACGAGAGATT
AAGTACGATATGAATTTTGCTTAAAGGATTAACTCTTGACTGAAATTATTTTAACGTCGTTTCAACGGTTTTACGTAAATAAACGTCCGAATTCAGTTTA
TACTTTTTTGGGACAGATATCCTTTGGCGCGCAAACCATGttcagctcgacgtcgacgtcgaagtccAATCTCCCAGCGCCCGTGCTGCCTTGGGTGGAG
AAGTAGTACGTTAATGgcttctctctctctctctcttcccTATATACATCATTTTTATGGCTATTccttgctgtcgctgtcctccAGCCGTCCCAagaac
gtggacgagatctccCACCAGGAGCATGTAGTGGCTACGCTCAAAACGTCCATTGCCAACGGTCAGCTTCCGCATTTGCTGTTCTACGGACCGCCAGGTA
CAGGCAAGACGTCCACCATCGTGGCAGTAGGTCGTCAGCTCTTCGGCCCGGATTTCCGCAAAAACGGCCGCTTCCTAGAGTTGAACGCGTCCGATGATCG
AGGTATTAAAGTAGTGCGCGAGAAGGTCAAGAGCTTCGCCCAGGGAGCCATCAGCAGTGCCAGCGGCCTACCGCCCTTCAAGATCATCGTGCTAGACGAG
GCCGACTCCATGACCGGAGACGCGCAGTCTGCGCTGCGTCGTATGATGGAGAACTACTCGAAGGTCACTCGCTTCTGCCTCATTTGCAACTACGTGAGTC
GCATCATTGAGCCCGTGGCCTCGCGATGCGCAAAGTTCCGCTTCGCCCCACTGGAAAAGGTCTCCATGGCTTCGCGTGTGCGCTTCATCGCCTCAGAAGA
GCACGTTAATGTGCCGGACTCGGTGCTGGAATCCTTGCTCGAGTGCTCAAACGGAGACTTGCGTAAGGCGATCAACTACCTGCAAAGTGCCAAGCAACTA
TGCGGAGATGACGAATTGTCGCAAGATGATGTAATTGCTGTGGCAGGTCTTGCCCCGCcagagctactggagcaaTTTTGGGTGTCGCTGGCTTCGAACA
GCTTTgaaaagatgaagacggacaTTGAAAGCATCCTGCTCGCCGGATACCCGGTACTTACAATTTTGCGGCAGCTGAATGACGATGTCCTCGCACTAGA
CAAGATCAACGACGTGCAAAAGGCCAAAATCTGTCTGCGTATTGCCGAGGCCGACAAGAGGCTTGTGGATGGCGCCAGCGAGCACTTTCAGTTGTTAGAC
GTCGCATCCTATGCCATGCGCGTTTATCATACGTCGTGATATGTGTAGGTGCTTGTTATGGCAACGACACACGAATAAATAAAGCGGAGTGGCGACAGTG
AATGAACACATGCACAGTCGAGTCCCTAGTATTTTGGAGATCACTGATTCCTGACCCTCGGGGGTCATCTGTTAGATCTAGTTGCTCGTGATTAAAGCTG
CCCCTTGGTCAGTCACTGAAGACAACTGCATCCACTCGTGATTGTTATGCTGCTTCCAGAAGGTAACTTCGTCATCACCAGCGGCCACGCTAAGCACGGA
GCCCGTTAGTGACCAGCTTATCCGGTATATGGCCGCGCGGAACGTATGAAGCACAGTAGACACCCACTCCCCATCAGCCTCATCTTGAGTCCAAACACGC
ACCGTGTGGTCGTCCGATCCGGACGCGATTACGTTCGCTGGGATACCAACATTCGGGGCCCAAGCCACATCGCGAACCCAGTCGTTGTGGCCATACAAAG
GAGTATTCACAACTTCCCAGTAGCTGTTGCCAGGGTTCCCTCCTTCTTGGGGTGCAGTAACGAACTGCCATATAGTAAGTGCATCGTTACATGACCCAGT
GACCACGCGCTGGATAGGGCCTTGAGCGCCTTGCGAGCCCAACGAGTTGTAAGGGGCCCAACTCACGGACGTACAGCCCATGCCCTCTTCCGAGTTCCGG
AAGCTCGACGAGATGACCCATCCCTCACGCATACGGGTAAGGAACGACACCTGGCCATCGGCTGATGCACTTGCCAGACACAGTCCGTACTCGTACGGCG
CCCAGGCCACACTAAGTACAGCCAGCGAGTGGAACTCGTGGACATGTTTGAGTCGCCATTCCGTCACGTTCCCGACTCCCCCTGCACCCTGCTGgaccag
ttcttctcggTATATGTACACTTTGCCGTCCTGAGCAGCCAGAGCCAGCACGGCACCGAACTTTGGGTGTGCCCAAGCCACACGGTGAATGGGGGCTGCT
GAGTCGTCGGCAAGAGGTACCACATGCTGGAGTATGTGAAGTTgttgctcctgctgctcttcccgACCATCCTTTGCAGCCGGATTACCACCGTTGTCTC
CATTAGCCACGATAGCCTTGGAAACATCGTACACGCGGAATGTTCTATCGGACGAGCATGTAGCCAAGCGTTTGCCGTAATAGTCCAGCTGAATGTCGTA
GATCATGTCGTTGTGCTCCGTGTCGATGCTCGCCGCAGGGGCCTGACGAGGCTGCACTTGTTGCTGATGGTGCGGCTGTCCGTACGGTGAGGTGAACTGT
CCGCTAGCCGTCGAGCCGTGCATGCCGCCAGGAAACTCCATCTTCGACTGATGTGGCCGGATACGAATTGTGTGATGGACTATTTCGCAATTGTGACCAA
ATATTGAGACTCACGAAATGAACCAAATTTGATTTTCATTTTGGGCGAAAGTGCAAAGTGATGTTTGCAGTCAATGGGCCAAGCGGACCGACGTCGCGTA
ATGAGCGGCGGGTGAAGAGCGACCGACAGcgagaggaagaggacgagacTAGGAGGCAATgggccgagaagaagcgagaACAGTTCTTTCTAGAGAAACG
TGCACAAGgtggcaacagcaagaaaGAAGGTAAATTCTGAAGTTTGTATGATCAACTGCAACAGCATCATTCATTTGCCATGCAATTGCAATTAAACAAA
GCGAAAGCAGAAAAACCTGCTGTGCAGTCCAGTATTTTCAAGGTTCGCTTTTGCTGAATGGTGTGGAGCGTGGACTTACTTATGGTTACCGATGCTGGTT
CTTGTCATTGCCGTTTGTCTACAGGGCTGCCGAATTGTTTTCAACGGGCGCACGGGCAAAGTGTCTTCGTAGGTGATTGCACGCATGTGATCAAATATGG
TGGCTGTGAcaccttcttgctgctcttttGCAGATACTACTTGGCTAAACTGGTGCAGGAACACGGTGGCAATGTGGCGTATGTCGATTTTGACTTTGGA
TGTTGCGGTGTATTTGCAGTTGATTaactgctggtggtgttgCGCTTGATTAGCTCAATGCTGACGTCCACACGCGTCACGCACATGGTTGGCTCCAATT
TGAACGGGTCCAAGGCAGACAAAATGCTCAAGGTATGTTATTCAAGTTTGTACTGGTTGATATCATGAAGCTGATAACGATGTTTTGCATGTCTTGCATG
GATTAGAGCTGTGGCAAGATGAAATTCGTGAGTCCAGGTAATATATACATCCACCAACCTGTAGCACATGTACAAGCTTACTGAAGTGTTATCCTACAGA
ATGGATATTACAATCAGTCAAGCGTAACAAGCGGCAATCTGAGTTCGAGTTCCTCGTTTACAAAGACAACAACGCAGGCTCGCTCCAAGCTGCTTTTTcc
cgagcagctccagcagccaagTAAATGCTTTCGTCCTACTACATGGATCACCACAGCAGTACCATGGAAAGGAAATGCGCAACACAAGCAACTTGTAAAA
AAGAGAAAGAATATACGGTGTATAAGGTCACAACTAACCAGAGTAGCATTCGTTGTCGCTCCTTCCAAGCCAAAAACGAGAAGGCGAGACCAAGGAGAGG
AGCACAGAAAAGACCTGAATAAGCGCAACCTGATACTCCTTTCCAAACGCCATCGGAATCCTCGAACAGCCTTTTCACCTGCGCCGCACACAAGCCCTTT
GATTTTATCCTGTCTGGACCTCCGTGCCGCGCCTCTTATGCCTCTGCACAAGATTCCGGAACTAAACTGCAGACAAATCAACTGGCGCGCGACGTGAGGC
AAACCGGACAAAACGACGCTGCTTAGCAGCACTTAGACCCGCCGTTGGACGGAACCTGCTGGCCGGGCGTGAGCTTGACACCAGCCTTGGGGGCCACAGG
TGCGTTAGCcatgcgcttcttgatctggGCTGCCATCATCATGAAGGCCTTCTCGACGTTGGCGGCGTTCTTCGCACTGGTCTCCAGGAACTCAATGCCC
AAACTCTCCGCAAACTCCTTGGCAGCGTCCGTGCTTACCACGCGCTTGGCCGTCAGATCACTCTTGTTAccgaccagcagcttgttgacgTTCTCGCAGG
CGTATCTGAAAATTACAGTGACGCAACGGTTAGCGGGACCCAATGCTAAAGAAATCCTGAAGTATCATATCACGAACCTATCGATTTCATGCAGCCActg
cttgacgttgttgaACGACTCTTGGTCCGTCACATCGTACACCACGATAATGCCGTGAGCACCACGGTAGTAGCTGCTAGTAATCGTGCGGAAACGCTCT
TGGCCAGCCGTGTCCCACTACACAAGCACAAGTGAATTGGCACAACCATTAGTCCAGCACTCTCACTAAATTGGATAACAAGTCTTAAACGTTGGATGCT
TACAATCTGGAGCTTGATGGTCTTGCCGTCCAACTCGATCGTACGGATTTTCTAGGCACATTCACAAATACCAGGTCAGCAATCCTGATAGAAATTGTAC
CTCACTGGACCTCTGCTATCAAACAGAGCCTGGTACTCACAAAGTCCACACCGATGGTCGAGATGTAGCTCTCCGTATACGTGTCGTCGGCGaaacgaag
cagcaaacacgACTTGCCGACACCAGAGTCACCGATCAGTAGCAGCTTGAACAGGTAGTCACTGCACACAGGAAGAACGTATCAGTTACGGCGTGGTCTT
CACTTCTTGTCAATAAATCAGTTCCGACTTAGAACGTACTATTCCGGGTTCATCTTGTGCGAATGTGGAGAAAAAGCGACGGGTGAAGGTGCTTAATCTG
AAGGACGAAAAGAATTCTGTCAGCTCACAGTATCAACGGCGGCTTATGGAGCCACACTCCTTCCTTTCTCCCCTTCCGCGGCTCCTGGATTCCGAAGAAA
GATCGAGGATCCACTCACTTCTACCAGCTGGTCGGCCAGGGGAGAGTGAGCAGGAAGCAGGGGGGTACAGAGGGGGAGTGTAGAGCGCCGCAATTGGCGC
TAAGTGAGTCCTAGAGGCACCTACacgaagagaaagaaggAAGCGACTCGCGCGTTCCAAGCGTCTTGGGTTGTGTGGGCGAATCGCAGATTGGTTTCCC
GTCCGATCGAGAGAAAGACTGCGCCGTTTTCCCTCGCCGAGGTTTTATTCGCAGAAATCGAGGTTTTATTTTCATTTCATCCGATGGAAACGTTCCTCAC
TggttttcagccaatcagatcGACCAGCGTGGCGGGGAGAAAGTCGTGTGGACAACACTATCACCATGCAAGTCAAGCCATGTCGCTACGTATGCCTatg
acgacgttgaaggcgtcCTGATCCTTGGCCCTTACGCATTCGGGCTCACTGTGGATGACAACGGGTGGTGCCTGCTACAACAACAGACCGAGGCTGGATG
AAGACTTGTCAATGTGGCCAATCGCGCTGCCTGTGTCCGTTGCGTCAAAGCGCAAGTTCGCTTGAGCTAATAATACACTCGTGGTTTGCCTTGCGACGAA
TGCAACTACATTCCTCTCGTACTGGTAACGCTGGCGGCCACTATCCGTGCAGCATGCGAGCATTATTGGTCacagcaatttgctgtcgACGTGCGGATTC
TGCTGCATCAGTACGGCTTGGCCATGTGATACGTCGGCGGGTGACTGTGCGCCGCGAGGGCCATACAGAACCATTTCGATGGGGTTATTACGAATAGCGT
GGCAGTCACCTTCGAGATAGACGCACTCCTGGATCTGTTACAAGTCCCTAGCATTCTTCCCAGCGCGTCATCGCCCACTTCATCTTCATAGAATCGATTC
TAGCCTTGTTGCAGagaacgctgctgctggcgaggCGTTAACATACAGATCCAAACCTAATAGGATATAGGCTACAATACATCGTGGCATGATTCATACC
TGTGCATGTACTTACTTACATGTACCTGTGTTCGCCGATACCAACGTGATTTGGCAGCTCGCAATGTGAGAGCCAACGCATCGCAGATTCTTCTGATTCA
TTTCTTCAACAAGAGTGTTGGTCGCTCGTCCTCCTTTTATGAACGAATTACGTACTGTTCTCGAAGCTCTATCCTTACAAACACCAGTACTTTTCTATTT
TAAGGACGAATTACACCCTAATTCCTAGTAGATGAGGTTCCTACCCGTAGGGGTGGGTGTTTGGATTGTTCCGCCTTCAGACCCCCCACTTACACAAAGA
AAGTAAGCCGAGAAGAAACGTCGAAGGCAAGTAACACAGATCAAGGCCCGGCCGGCGCTCGCCACCCCGTGCCGTGGTCTCACTCTACATGCGTACGTGT
GCTTTCATGTGGCGGTTGTACATCGCCAGTTCTCGTCGCTCAAGTCGATCTGCGGAACGCGAAAACTCGGGCGAAGCGAATTCAACCCCACATGGAAGCA
GACGTGCATTGCCTGTGAATTGTGCTGGTTATTGAGGGTCACAGGGTGGCAATTTGGAGTGCTAATAGTGCGCTGCGACCCTTCGTGACGAGGTACCGTG
TTTGAAGCGGGAAAGAGGCTAACTGGCGATGCTTGTGTTTGCTGTTTTGATTTTGCTGTAGGCGTAACTTATCTcggagaagcgcaagcgagAGGAAGAT
CACGCCGCCAGTCTTTTTCGTAGCAACGATGAGTTCATTCAAGAAAGAACACGCGTTTGGTGCGTGCTGCTTTACGGTTTCTCTGATATAGACTTTTGTG
GGAAACACTAACGACGCTTGACGGTGCTCGCTGTTTGCAGAGAAGCGCCAGGCCGAGGCTCAGCGCATCCGATCTAAGTACCCTGACCGAATTCCGGTAC
GTGCGCCCAGTCGTGTGTTAGGTGTGCATTAGATTTATTTCACTGACGATgttttgtggtggtggtgaaggTGATTTGTGAGAAGGCGGATCGCAGCGAC
ATTCCAGACATCGACAAGAAAAAGTATCTGGTGCCAGCCGACCTGACAGTCGGTCAGTTTGTGTACGTGATCCGAAAGCGCATCAAACTGAGCCCCGAGA
AGGcaatcttcatcttcatcaacaacgTCCTCCCACCAACCGGTACGGCTCCAATGTATTTCAACACGTATTGTGTATTTTTTTGACgttgcttcttctt
tttgtttGTTCAGCTGCGTTGATGTCAAACATTTACGAAGAACagaaggacgtggacggcTTTCTCTACATCACTTACAGCGGCGAGAACACCTTTGGAC
AATAGTTGCACGTGGTGTTGGCGAGCGGGGACTGGATTTTGGTTGAAGATTTTTTTTCGTCGTCCTGTAGTGGTGGATTGGGAGCTCTTTAGGGAGCGGT
GCCTGGTTGTCAGCTTCAGATTTTCAGGCTCCGTTTTCTGAAAGAAATGGTAACAAGATGAAGTCAGGAATGCTGTCAGGCAGCCAAAGACGACAAGGAG
TATTTGCTGCTACGTGGTCCATTCTTCTAATACTGGCGATGTGGATATTTCCTAGTAACGAAACCCCAGAAAAATACATGCAATTCTATTCACTCGCTTA
TGGCATCCGTGAGTTGTTGTTCTAGCGTGTCACTTCACTCGCGTTGGAACTCCATCATCTGCAGGCCTTGGccaacgacaacgacttcATCAGCTGTCCT
AGCTTCGTTTTGCCGAATCGCAAGATCAGCTATATCGGCGCATTCCGAAAAAGCAGCTCCTTGCCACTCAAGCTCGGTGCCATTGTCGTCGTGATGAATC
CCCCACTTACTCACTCGCTGGTCGTATCCAGCGGCAAAAATCGTTTTGCCATCCACACAAACAACAGTTTTGATAGCAGAGCCACTGACATTCACCGTGC
GAGCTTCGGAAAGCACTTCGCACGATGGGAAACGCAGCTCACACATACTCAAATTCTGATCATCTCCACCACTGACAAGCCTCACGTCAAGACTTCCCTC
TTCCTTGTTCCATTGGCAAGAGACAAGGTCGATGCAGTTCACTCCCATGTCGTGCGCCAAATAGTTGCCACTAGGTTGTAACTCGCCAATCAATCcttga
agcttcttcttaAACTGTCCCGCATGCTCCTCAGATAGAAGAAGCGAAGCGATCTCCTTAAGCAGCACGCTGAAGTCCCATAGGGTCACTAAACCATCAG
TAGAGCCAACAGCCAACCCAGCAGCCACCGAATCATCACTAACTTGAAAGCCCACACAGGACAAAATGGGCTTTCTTGAAACCGAACGGCAGTCaccaag
ttcaagaaggtTGCCATGGTTCGCATCCAGAAGCAATAGCTGAGTAGATCCCTCCGAATTGCAAGCTGCCACAAGTCGATACGCGTCTGGCACAGAGGGA
ATCTCAAACGTAGCAAGTCCGAGAATGCGGTggtcttgagctgcttcggcACGCTCCTGCCCACAAACATGGCGGAGCAAATCACTTTCCCCGCGAACTA
TCCACATATTTAGACGCTGCTTGCCACCTCCTGAGAGAATGATGTGTTCGACTTGATCGAGGTTTTTGCGTTGAAACGTTGTGAGTGCTCGAACAGTAGT
CGTATGGGCAATTCCTGTTGCCACACTGCCCCAACGACGCTTCTTCAGGTTTACGAGGCCACGGCGATGAAGCATGAGGCTGTTATCCTCTGCTGCGGTA
ACCAGCCGCTCGCGTCCAAGAAATGCCACACAAGTTGTCATGCGTCCGTGATGGTGGTCATGTAGTGAGCATCTCGAGAAACGTGGGGGAACGCCAGCGG
CATCGCGCGGACTCAGAAGAGTCGAGTGCACTTTGATGTCAACCTCCTCCTTTTCAGTCCCTGGCGGTGTGAACACAAAGGTGTGTGCGGGCAAGGCAGA
GGCAAAATCTCCCGCCGTCGTAAAAAGCGCGTGAGGGCGGCGCCAACCACCACATTCCACGTTGAATAGACGATATTGCGCAGAGAAGTTGTGAAGAACA
GCCTGTGCCGCGTGGAACCCAAAGACCATAAGATCGGGCTTCGTCTTAGATGTGCTCCACCAAAGCTGCTTGACCGTGGAAATCCCTCGAATGGACTCAC
GACCCACCTGTACCGCCGTCAATGCTCCATCTGaatcttcttccagcgcatACGAGCAAATGTACCCGTCATGTCCTCCCGACAGCATGACAGAGTGCTG
CTTCTCAGTATCTTTGCTCTCTTGGGAAAGCAATAGTGATGCCACTAATTCACGCCCGTGGGCACCTTTCAGCACGAGACCTGGAGCTTGCACCGCCTTG
GGCTGATCATCACTTTCCGGCAAGCTGAGCGGGCGATGAAACATATACACACTGCCATGTCCGTCGCCCGCAACAATATTCCTGGTTATACCCAAGCGGT
CCGCCACCAAAACAGAAGATACCGAGCTCTTTGCAGGAATTTTGAACGTTGCAACAAGTTCCATCGTAATCGACGGGGATGCCAAGTCTTCACTGGCCTC
TAGAATTGTTGGCTTCCATTCAGAGAGGATGCCGCTGGCACTACTGACGAACAGAGAGCCATCATGATCCCACCAAATCTTCATAACCCGCACGTTGCTT
TGGCTAATCCAGGAGTACAGCAAACTACCCGTGGATGCCTCAACGATGCACACGCGACCTGTTACctcgcccagcagcaagaagcggccCGAATGATCCA
TTGCAAACGTCGACAATCCACTCCGTGTTTGAACGCCAACATCATCAGTTCGAGGAACCGTAAAAAAGATCTCGCTTGTGAGTGAAGACAAGTCCAAACG
AAAAATACCACCGTGCTCGGAGGCAACAAAAGCTGCCTTGCCATTGTCCTGGGTGCTGAGAACGATGTTGCGCACGCTGTGCGATGACAACGTGCCTTTC
TTCCTTTTTGGTGTAGCAGACGTTGCTGTGATAGGAACACGAATTGTCTTACACACCACACTATCTCCAGAAGCAACAGACGAAGACATGAGCTGGTGTG
TGACGTCCCAGAGCTTCACCGCGCCGTCTCCGCCTCCCGAGGCAATCATCTTTAGCGAGGGGTGGACCGCTGCGCGCCACACGTGCCTGCCAACGTGTCC
CTGTAGAGTGGAGACACAGTTGCCATCAAGATCCCAGAGCTTGCAAAGACCATCCTCGCTCGCGGTCACCACACCGTGTTCCCAAAACGATACATCCCAA
ATGCGCGCCGTGTGACCCCAAGACCGGAACACTGGAGAGTATTCAGTCGCAAGTAATTCAGCTCGTGTCGATGATCTTGGTAAatgaagctcttcagctg
TGATTTTTCCTTTGTTTGACCACAATTGTACCGTGCGATCATCAGAGACAGAGGTCAGCGAGTGGGCATCTGATGACCATGCCAGTTTAAAGAGTACGCC
ATCGTGGGCATGCAGCCTTTGTGTAGGCTCAACAGCAGAGTTCATCTCTTCACTCCCGTCCTCCATTGGATCCCAAAGCAAAATCTGCTGAAACACTGTC
CCTGAGGCAACCACAAGATCGTCCAGCGATCGGCCGTGAAATGCCAATGCGTACAAAATGCAGCGCGCGGAGCACTGCACGGTGCGTAGAACATCGTTGC
GTACTGGGTCCCATATTTGCACAAAATTGTGCGCCAATCCAactgcaacaagaagattCTTGTCCTCGTTCCCAGATGCAACGTCGCTcgtcaggagctg
cacaTCGAACACCCAGTCGCAAAACACTTTCGGTTTGCCCAGCACTGGGAGTTCCTCGAGCCCGTGAGCAGCCTCAGGCGTCTGCGGAAAGTCCTTGAAA
CACGACACCCGCTTCTGGCCGAAGAATGCGCCTACAAACGCCTCCGGTGTAGAGTCTGGAAGTCGGACGATGTCACAGCCGTGCAGAATTCCTCGCGTCA
GCACGTCGTGCTGGCATAGACACTCGCCAGTCGCAGTAGCATACAGGAAAACAGTTGGGCCTACACCCACGTAGAGTAGCGATCCATCCGATGAGAACGA
TACAAGCGTCACAGCGCCGAGATactcctgcttcttgatcgGTCGGTGCACCATGGCGTCCATTGGCTGCGATGATGGCCATCCATGTGCTGGTTACCGG
TTTTACCGGTATTTGCTAGTCGCAAAAGTGAAACGTTTCGCGGTGGCAGTTGGAGTTGCACATGGCTACACATTGAAGAGGATGTAGTAGATTGGATAAA
TTACTTTGCATTTTTAAGCCTCACAGCTGACGTTGTTGCAAGCTCCAAGAGCAATTCTCCAGCCATCTTCCAATGGCACAGGCGCGCTGGCAGCCCGTCG
AAGACTGCGGCacttctgttgctgctgcttgtactcgCTGACCTTGGAATATACAGGCTTCTCCATCTGGAGGACCTTCCAGACCGAGCGAGCTTTGCGG
AACTCGATCTTGCTCTTACTCGGATCGGAGACGGGTGAAAAGTTGTCGGCTTGCAACGCCTTTTTCAGAGTATCCAAGCTAAGGTTATTAGGAAGGACAG
CGCCTTGGAGGAAGAAGTCCCGAACGACTGGGAAGATGGTTTTGGCGCAGGCAATGCACTTGGGAACCGCAGAAAATGTGTGGGATGCCAGTATCTGTAC
GAACTGATGGAGCCCAACACGACGCTGGTTGATAACGTCAGGAGACCGCGAATTCAAGAGGTGGCGTCTTGGGAACAAGTAGCTGCGTAGGGTTTGAGTG
AACCACGCGCAGCCAAAGCACTGCGGGCGAgcaccacctccacgacgcaagaagaaggagtgcagcaccagcatcaatTCCCGGAACTCGGAGTATCTGC
GCTCCACTGACCACTCGAGATCCGTCTTGGCAAGAGAGCACTGCAGCACGTACCGCGTAGCATTGCTCGTGCGAATGCTAGGCTTCACAttcaccagctt
cgccacaAGCTTTGGGTCGAGGCTGTTGGGTCCGCATGCGATATTGGAGTGGAAGCAATCGTCGTCGAGGTACATCGTGTTCGCTTCCGAGGACCTTGAC
TACGTGTGACTAAGCGAAATGCAAAGTGAGGACTGAAAGATGTACTAAGGAGTCCTTAGTAAGGACACCGCAAACTTGCTGGTGCTAATTGTAGACCCCA
GGGGCCCACCACCTTCACCTTCTGATCCGCA