Description :
From Genome Similarity Track
Location :
contig_4:129938- 132312
Transcript NameFunction/comments
g1071.t1hypothetical protein PHMEG_0006078

Sequence
2374 bases(100 bases per row)
TACATTTGCTGCGAAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCTGCATAGAGGAGTAACTCGGATAGCCATTGCCCGGTGCGTTGCCATTGT
TATTGCTGAAGCTGGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGT
GCCGAGTCCACCACAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCA
GGTGGTGCGTGAAGGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTC
TTCTTCTTACTGGACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGC
GCTGGGGAAGCAAGCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCC
TGCTCGCCATAGCTATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGT
GCATCCTCAGTCCGCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGA
TCGACAAGTATGATTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTT
CAGTGACAGCTGCGAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAA
GAGCAGTGTCGGCAAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCT
GAAGAAGGTGAATCTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGG
CTACTGACATTGATGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTC
AGCAACTCGAGGATCACTTAGCGCTCGAAAAACTATTGACAAACACGTGGAAAGCAGCAGCGGCAATAACAACGACCCATCAGCCACCGGTTCCGATAGC
TGGAAGACACTGCAAAAGTTGGCGCCAGCTCAACACGAAATGCTACAGAATCTGCTCCGTTTGCCTGAGAAACAGCTACTGAAGCTACCAAAGGCCCAGC
TTGAGCTCGTGCAGTTCGCCAAGCGATATGACAAGCTCATCAAGGCTACACCCGACCAGCTTCGCCATCTGCCGATTGAGCACCAGCAGCTTGTTCGAAG
CATGCAGCAGCAGCAGCAAAAACATGTTCCTCGCACTGACGAATGCAGTTAATATGGAAATTAACGCTTAGCTAAAACTTCGTCAGACCCTACAAGCATG
TAAAAAGTAAAAAGTAATATCTGTGAAGCCACATTTCGTTCATTTCTGTCAGTTGTCTTGGCCAGCCGGGTGCGAATGAAAGCTGCTGGTAGCAACAAGC
ACGAGCTTGTGCTTCGCGACAAATCCAGCAACATCAAAATTCGAGCGTTTTTCAGTTAGGTCGTCATCCGGCGCATCGGGAGCACTTCCTTCCTGGCGGA
AAAGCAGCGAGACGTAGCGGTGTTCCCCCGGGTGGTGTCACCGGGTAGTACGGCACTACTACTACGTTTTGCGGCTGGTCTTGAACACTCTGCCCGTCCA
CAGCTAGGCCCGCCAAGATGTAGTGCAGGAACGGCGCGTGCGTCGGAGACTTGGGATCCGGAGCATCAATGTCGATCAGCACGTACGTGTAGCGCCCAGC
ACTGCCAGCTGGGCTGCCTTCAATAGAGACACTCGGTGCTTCTTGAGCCTAGCAGTCAAGACGAGCATGATGTGAGACTTGCACTTCGTCCAACGGATTA
AAAGGTAAAAGATCTGGTGGTGCCAACCTCCTTCATGGGCACAAATTGCCCCAGGGTCACGGGGTGGCCGCCATTGAACGCGATAGCGATATGGGCACTG
CTCCCGTCCTGGATTTGGAGCTGCAGCTGCTGCAGAACTTGCACGGGGACAGAGTCGGTGTCCATTTCGGCTGC