Description :
From Genome Similarity Track
Location :
contig_66:129938- 131423
Transcript NameFunction/comments
g9587.t1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1485 bases(100 bases per row)
CGTGGACGGCGGTGTAGTTGTAGTACACCTCATTCTCGTACTCGCTGTCGCAGTACGGGAAGTCCGTGTCCGAGTCGGTCGGCGCGAACAGCGTCTTGCC
GGACGTGTAGGTCACGTAGCAGCCCAAGAAGCCGCACACGATGACGACGATCAGCGCCGGGATCTTCTCGTACATCGGGATCTCGTGCCACAGCTTCTTG
AGCAGGAAGATAATGGGCAACAGGATACTGATGAGCGTGATGCACGAGGCGCCCACGAAGTCCACCAGGTCGGAGAAGTGGTCCTTCAGGATGATCGAGA
GGATCACCAGCACGACGATGATGGTAACACGAAGGATCACGTACTTGACCGCGTTGGAGCCGCGGTACTCGGCAGCCTCCGCCTCGACGTCGTCATAGTA
CGGGTTCTCGGCGTCAGCGTTCGAGATGTACGACATCTTGGATGAGCGGCGGTCGTCGCCGTTGACAGCGTCCTTGGCGGGTGTGTTAGCGGCGGCGTAC
GAGGCGGCAGCATAGGTGAGAGCGTTCTCGACGTCGTCCTCCTTCTTCTGGTGCATCTTGAGGACCAGGCGCTCGGCAAGGTAGAAGGCCGGGTTCAGGA
TGACGGAGAAGGCGATCGTAATGTGCAGCTGCATGAAGAAGTAGGCCATGACGACGGTGCCCCAGTTCGACTTGAAGCCCAGCGTGGTGAGGCGCTCGTC
GAGTCGGGTAGGATGGAGTAGAGCAGGTTGCCCGTGATCTGGCAGCCCACGGCCGAGTACGCCGTGCTGGCCAGGATCAAGAACAGGCACGAGATGAAGC
CCATGGTGACGAACACCACGCGGGGCATGCGTGTCGGCTCACTGTGCTGGCGCTGTAGGGCCGGAATTACAATACCCGCGTTGTACGCGAGCGACAGGTT
GCCGAACATGCCCGCGACCTGCGAGAACTGATATCGGGCGACGGCACAGGCGGTGGCCGCGCATGCCGTACATGACGACGGCTACGCCAATAACATCGGC
GATGATCGTGCCCGCGCAACCGGCGAAAGCGACCCCAGCACCTTCCTTGAGCGTCGGGATGAGGCAAACGGGCAGGCACAGGAGCGCCATGAAGCAGATC
CAGTAGGTGGTGCTGAAGGCGTCTGGGAAGAGGCCGTCGAGCAGGGTGCCGCCCAACACAAGGAACACGCACGGCACAAGCAGGCACGAGGCCATCTGCG
AGATGACCGAGAGCCAACGGCCCCACTTGCCCATGCACCACTCGCCCAGGTCGCTGTAGGTTTTGACGCTCTTGGGCGCCAGCAGCATGACGCGACAGAT
GGCCACGGACGCGTAGACGTTGGCGAAGGCCATGAAGGCCATGCCGACGACGGCAAGCACGGGGCCGGCACGTGAGAAGTTGCCGGGCATGCCAAGTGTA
CCAATGCCGTAGACGCAGCAAAAGATGTTGAGCGCCATCTTGAGGTCCTCCGCCGTGAGGAATTTCTTGGCGCAAACCATGGTGG