Description :
From Genome Similarity Track
Location :
Scaffold_62:129908- 131634
Transcript NameFunction/comments
g17436.t1hypothetical protein

Sequence
1726 bases(100 bases per row)
TCTTGCTAGCACCAGAGGAACGAGAGAGTAATCTATATAATACCGTTAACATTTGAATGCGTACTCCCCATGTGTCTCCCGTACTTCATCATTGACGCAA
GTGAGCTCACTCGAGAAATGCAAACACGCACTTTTTGTCGGACTCAAGACCCCCTCCCGGCTCGATACAACCAAACAGTGGCGTTACTTGTTCGTATGAC
TACGTTGGAAAGAATCGTGCCTTTCTGAGTTCATACTTACGGAAGTCCCGCTGCCACGTAGTGCATTAATTAAACGCTTAGCACGTACTAAACAAGTCGA
TTGGCAAAAGTACTCCCTGAAGAGGGCCACGGGCATTCATTCTCCCCATTTATGACCTCTCCACGCAGCTTTAACTGCATAATGTAGTCATGTGGATTAT
TGCCCCCAGTCTGGATCAACGGATTGATCCTCACTTCGCAATGTGGAAGTATCCAGGAAGGATACTCCTATTTCCGAAAGCATAAGAAGCGGACGACGTG
CTGCTTCATCGCAGACTGCGACAAGGTCGCCAGGTCAAGTTTAGAGTAGAGCGTGTAGTTATCGTAGCTCACTTCCGTTCGCACATCGTTCGCAGCACTC
GAAAACCCCCCCCCCCCCCAAGTTTCCCAAGTCTCACGACCTGCCAATGGCCAACACGGTTAGCGTCGGAGTCCTCGCGTTTCTAGGACCATGTCACGCA
AGTCAACTGACCGACTTTCAGTACGTCGAAGTAGAAGACGTCACGGACAGCGTGGCTGTGGTCAAGATCACGGGCCCCGACGACAACGACCAGGCCATCA
CGTTTCAAGTGCCAAAGGACACCATAATGCGTCGCATGGTCTCAGATGCTGAACGCAGACTTTGGCCAGGGTCATACATAGCCCACACGGTCGCCTTCGT
ACACACATCACCAGCTGGCGTCGATGCATGGTCGTACGGGGTCGTTTCGGGCTACACAGCATCCGAAACGACCGATATCCTGCATATCGTGAGCCCCGAA
GGGCCGACTCGATTGCCTCTGACAGACGCCCATTCGGTGATCAAGGTGGACTCCCTTAATTACGCATTACAACCCGGACAGGGCGCCAACGCGGTTGCGT
TAGGACCAATGGAGCTACTTCATCACCAGGACTCAATCCTGGAAGCCTGTCGCAGGCGAAGGTCCGGCGTCCCCCCCACGGTAATGTCTGGCCTATCCGT
CCCCTATGCACCAGACGACAACGTTCCTCTTGTGAAACCAGATACTCTACAGCTTGTACACGTCCGTCGCCAGCACATCGTCGACTTTGCGACTGCCAGC
CGTACCAACCGACCCAACGATCTATATACGGACAACGCTCCGGTCACAGAAACTCCGGCGCATCTCGAAACTTCTGGAGCGACGACCCCAACACTTCGAA
GGCGTCGCCGGACCCCGCATCCGGTAGTTCATCCAACGAGCCACAATAGCTCTGACGACGATCAAAACGCTAGTTTATCCGAGGACGATGATATTCGTGA
AGTGCAGCACATGAATGCACCTTTATCCAAGCGACGGCGCGTTAACAGCGGCAATAGCTGCTCCGATAGCAGTGACGAGTCATCTTCTCATCGGTTCACA
CAAGCACAGAAGGGTATTGTTTTCCACCCCTCTCCTACCGACCGCCGCATTCACGCCGCAATTGTCAACCGCAGCCACACAGGTACGATCCCTCAAAACT
TACTTCAATCTATTCAGCAGTCACCA