Description :
From Genome Similarity Track
Location :
Scaffold_314:1299- 3182
Transcript NameFunction/comments
g11335.t1hypothetical protein

Sequence
1883 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGACTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGACAAAGGTGTTCAGCACGAGATTGATCTCGTGCCAGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAATGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACC
ACAAGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCG
ATGCCCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATGCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTC
CGAGCGGCATGCTATGGGGGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCG
CGAATTCGCACCGAGCTATTTTGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGTAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTG
CTTGAGCTCATGCAAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACG
GCGTACACCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACG
TACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGACCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGC
AGGCCTTCGAAGCAGTCAAGCAGGGCTTGGCTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTT
CGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGAGATCGTGTGGTTTACTACCAATCGCGTCATCTGAAGCCAGCTGAGCGCAATTACCCG
GTACATGACAAAGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACGTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCAT
CGTTGCGTACGGCGATCAAGTCGCCGCGCATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGG
AAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTACAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCC
TCGTCGTCCTTATTGGACGACGTGAAGGCCGCATACGCACATGACGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCGCACCTTCTGACAAGTCTCGTC
AGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTTGACGACAACGCAGATCGCATTGT
CGTGCCGGATGATCATGATCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTC
ACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC