Description :
From Genome Similarity Track
Location :
Scaffold_33:129878- 136832
Transcript NameFunction/comments
Physo_134639reverse transcriptase
Physo_134640pol protein

Sequence
6954 bases(100 bases per row)
CTTTGGCTCTAAGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTC
TTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACGTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGT
GCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGTGCGCCGCCAGACTGTCGCACGCAATCGC
GACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACTTCGGGTCCACATGG
ACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGTATGCCGTGGCTGGAGAA
ACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGGCCAGCCGTCCCCCACGCTCTGACCGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGC
AGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCATCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCC
TGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCAC
CGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGTAATTGATGAGGAAGGTACTCCAGGCGCTTCCGATGTGGGTAACATAGTT
CCACAGGAGGTCACGCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTC
CACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAATGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGACGCC
ACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCA
GCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGC
TGAACCTTGAGGAGCTCGCCATGGAAGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGA
GTTGAACTCGTCCTCGTTCATGGACCAGGCAGTCCTGGAGAAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGAC
CCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCG
TGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGATCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCATGCAT
GGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGATGAACTGC
GCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCGTGTGGACGGAT
ATTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTC
TAACGCCCTGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCATTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTTGTCTACAGCCGT
GCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGTTGTACGCCAACATCGACAAGT
GTGTGTTTGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCC
GCCACCTCGGTCGCAGAAGGACCTAGGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCG
GATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGCCCTGGTAT
TGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGACTGTGCGCTATTGCAGGCCAACGATGAAGGCCGCGAACGGGT
CATCTCGTCCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGA
GTGCACCTCCTGGGCTCGACACCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACACAGCATCTCTCACAGCGGATGGCGCGTT
GGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACAAGCT
TGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACGTCTTGTGCGGTACTTGGCCGCT
GGCTCGGAAGCCAAGGCTGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCAG
AGGATCATCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGA
GAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGGGTGAAG
CCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCAGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGCTG
ACCGTAGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGATGTCGCTCG
CCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCGCCGCTACGTTCTGGCAGACGCTGTTT
CGCCTTCTCGGCACGCGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGGGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCA
GTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCCTTACGCCCTT
TTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTTGGAAAACCTTTTCC
TCCCAAGTCTCAGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAACAGGGTGCAAGACACCATGG
CGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTATATACTAGAAA
CCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCAGCGTACACC
ATAGACTTGCCCAAGTCGATGACGACTCTCACGACGTTTTACGTGGATCGTCTTAAGAGGAACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGG
TGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTAC
ATCGGAGCAGAATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCACGTGGCCATGAA
GCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATA
GAGCGAGGCAACATCCTCACGGAGCTGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCACCACCAAGGCCGACGCCAAGCGCGATCTCGAGG
ACGTACACACGGTCCCGGAGTAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAACATACGGCTGCGTCGCCTCAGGCTCGTAGC
CATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGCCGTCCGGGAGCGGCGGCTCCATGGCAAGC
GCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTACCCGAAGGCTGTTGCGATATA
GGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGCCGCACCACGCCCACGCTCTTCAC
GAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGAAGCTTGCGCTTGCTCACGTGTTGAGCGAACTCGATGCGGAGCTCGCGCACCTC
CAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTAGTCGTAATACCCTTTGCACTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCG
CTCCAGGTCATGTTGTCATTCGGCTTGGCCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCT
TCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTAAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACACTCATAGGAACC
CCTCAAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGG
TACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCT
CGTCGAGGTTGTTGGAGAGCTCCTTGGGATCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGGTGGAGCCGCGAGGCGA
CCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGA
TGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGACCATGGCGACTTCGTCGTGCGACT
GCTTGCTGTCGCCTGAGTCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCATCGGCCGAGGCGTTGGTCATGTCGCCTTCCGCCAGCTC
CGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCT
TCCCAGTCGCGAGTCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCT
CCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGG
CCCTACGGCCCGCGGTTTCGGAGGTGCTTTCTCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGA
TGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAAAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTA
ACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACAT
CGGTCACTCCCTGGATAGTGACCCAAGCGACCTCAGAGCCAACAGATACATTTTGTATGACACAGACTATAGGGAACTTAGGATTTGTATGCAGCCCAAA
TCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGA
GTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACAGAT