Description :
From Genome Similarity Track
Location :
contig_48:129874- 133939
Transcript NameFunction/comments
g10274.t1hypothetical protein

Sequence
4065 bases(100 bases per row)
CCTTACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCTTCATCTGGATCACCGGCGTGGTTGTCGATTAGCATGTCGCGTGAAATCTTAATGTAGGC
ATTTCCCAGATCATTGTGTACCTCATGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCAGCAGCACTATCGGAGGTGGCAGCC
GTGCGAACATGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTTTCTGTAGCCGAGCCGC
CCTTCACCACCGGGAGAATTTGCCTGAAATCTCACGAAAGGAGAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCT
GTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAGCTTGCTTTCTTCGTCAATTCCGTGACCTGAGATCGCTTGTTG
ATGTTGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGTAGAGAAGCAATCCCACTGGAAG
CGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTTGCCAGTATGTTCCGAAGCAGTGTCGACTGCCCGGTACCGCCTGGTCCATCAACGAAGAATAG
CTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCA
AGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGAT
CAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTC
TCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAG
AGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGT
CTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTC
CAAAATCACACGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTT
GGGTATATCCTGGTACAGCATTGTCTCCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATTGTGTGATTCCCACGA
CCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGA
TCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCC
ACCCGCGCGAACTACCTCGACAGGTAGCACAGTTTTATCAGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCG
ACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCCTTCCATACCA
GGACGCCTTCAGCTCATCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTT
CCCGTCCTTCATGCAAGCGCATGATGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACATTTCTCTG
TCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTC
TTTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACG
GGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAATGGCCTCGACTATTTCTTCCCATGTAGGGCTGCAGTTCGTTGTCATGAACACA
TCAGGCTTGCTGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGC
GTCCCACTTGTTTGAGAAAATGGGTATCTACATCACGGCCTCGATCAGGGTGGACCAACGTACTATCGCCTCTGTCAAACTCAGAGAGTAGCCCTTCGCC
TGCTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCATCCTGAAGCTCTCGGTACTGATCGGCGTGAATTTCATTTCTGATGTGAGGCCACCCAGCGAAG
TTGCTCCTGCTCGCACTTAGCGCGTTGGTCGACACACCACTGGTGAAAGAGACGACCACCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAAC
CGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCTGTTCGCGTATGTGTCTGTGTAGGTACAACCCAGCTCCCCATACG
GAAGCAGAAGAGGGTACTGGAGAAGATCATACTCCGGACGCGTCTCGAACAGTCGCAGAAGCCTGTTATCCCGAGTATACAGTAGTAGGTCGCGATGCCT
ATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTAGGCAAATTGTATGCCCGAGGATGCGCTATATTTTCTTGGAGGCGGAACACC
ATATCCACGACGTCGCTCGTGTTTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGTTGAGCGAATGGGTTGTGCTGCTCCATCATTTGCTCAATGT
CCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAGTATAGATCTGCGCGAACTTAGG
GTCTGTGCGCTCTCCGGTGGCGGGATCGATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGT
CCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGT
GCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCGGTTT
TGATTCTCCAGGCCACTTCCAAGCACCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCC
ACGTCAAAATCCTCATGGTTTGCAGACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCAAGTGCTTCTTCCTCAGTCT
GTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACCATGCGTTCTTCGGCGTTCCTCCTGCGTAAGTTGTGATCTGCGCTCCGCGTGTTGCTCTTGGT
TTACCCTTCGCGCTTCAGCACGCTCCTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTACCATTCGTCTTCGGCACGCTCCTCCTGC
GTGAGCTGTGATCTGCGCTGGGCATGTTGCTCTTGGTTTACCATCCGTTCTTCAGCGCGCTCCTC