Description :
From Genome Similarity Track
Location :
Scaffold_109:129857- 134144
Sequence
4287 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGAAAAGTTTGATGATGGC
TCCCAAGTTGTATCTTCATAGCCAACCCACTTGACTTTGAACTCGCGTATAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTAC
CAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAGCCACGCCCGGCTCCCAATCTCGAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCTATTTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTCTTC
GTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGACGACTCAGAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGT
GGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAATACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTA
ATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGATACGATCTGGAAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATCCACGAAACTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACAGGACTTCACGTGCTTCTCCACGTCTGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTTTGCAGGACCTCTTGAAT
CATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCATCTTCTGAT
AACACGAACCGGTCAGCATACTTCCAGGCATCTCGAGCTTCTTTGTAGCTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCT
GTTCCTCGTCTTGTGCCACTAGTATCCGTCTGCGTAGCTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCCTGGCCGATTGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTCTTCTTGAGCTTTTGAGACATCCTCCGAGTGT
TCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGA
AATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTTGTGACGAAACATCTACCGAGTCTTCATCCGG
CTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTTGATTCCAGCGCTTCAGTG
GCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTA
GCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCCCCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGC
AGCCTTGACACCGTTTATCATACCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGG
CTCCACAACACCCATGATCAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCC
TGGCGTACAGCAACGCGGGGTCCATTCGAACAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCCTCCAGGTCAACGAAGCTCGTGAT
GCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGTACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGT
CCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGCAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACA
GCAAAAGTAACGCCAAAACTTCCTTGTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTC
ATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGT
GAAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGT
AGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAGTTAGCCGCTCCAAGAAACGACTGCATCCCCTTCTTACTTGTTGGAAACGAAAGCTCGGCGACGGC
CGCACGCTTCTTCGGATCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATG
CTGATCCGACACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCTAGACAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACC
GTCGACCAAATACAGGTACCACCGATGATTCGTCTGGCTCCCCGCTCGTAAACATGTCAGTGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTC
TACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTC
TCCGAGTATTCAAACCAACCTCCTTTAGGCTGACCGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGG
GCATGCGTAACCACTCAAAATGTCCTAGTGCGCAGACGAACGCCGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATC
CAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTG
TAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGAACTGTCTGAAAAGACGATCAGCCCTGCACGCA
ATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTGGATTGGAGCATGCCCGTGCGTGTCGATATCGCT
TACCGCGCCATAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCCGGATGTGCTCGTGGTTCTTTAGCGTTGCGACCAGACGTTC