Description :
From Genome Similarity Track
Location :
contig_4:129849- 132241
Transcript NameFunction/comments
g1070.t1hypothetical protein, variant 2
g1071.t1hypothetical protein PHMEG_0006078

Sequence
2392 bases(100 bases per row)
TGGTGTACCCAGAGCTGTTGCCGTAATTGTAGCCGTTTTGGTTGCTGGCAGTGTGTGCGGTCTGGTACTGGTATGGTTGCTGTTGCTGGTACATTTGCTG
CGAAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCTGCATAGAGGAGTAACTCGGATAGCCATTGCCCGGTGCGTTGCCATTGTTATTGCTGAAG
CTGGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGTGCCGAGTCCAC
CACAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCAGGTGGTGCGTG
AAGGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTCTTCTTCTTACT
GGACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGCGCTGGGGAAGC
AAGCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCCTGCTCGCCATA
GCTATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGTGCATCCTCAGT
CCGCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGATCGACAAGTAT
GATTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTTCAGTGACAGCT
GCGAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAAGAGCAGTGTCG
GCAAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCTGAAGAAGGTGA
ATCTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGGCTACTGACATT
GATGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTCAGCAACTCGAG
GATCACTTAGCGCTCGAAAAACTATTGACAAACACGTGGAAAGCAGCAGCGGCAATAACAACGACCCATCAGCCACCGGTTCCGATAGCTGGAAGACACT
GCAAAAGTTGGCGCCAGCTCAACACGAAATGCTACAGAATCTGCTCCGTTTGCCTGAGAAACAGCTACTGAAGCTACCAAAGGCCCAGCTTGAGCTCGTG
CAGTTCGCCAAGCGATATGACAAGCTCATCAAGGCTACACCCGACCAGCTTCGCCATCTGCCGATTGAGCACCAGCAGCTTGTTCGAAGCATGCAGCAGC
AGCAGCAAAAACATGTTCCTCGCACTGACGAATGCAGTTAATATGGAAATTAACGCTTAGCTAAAACTTCGTCAGACCCTACAAGCATGTAAAAAGTAAA
AAGTAATATCTGTGAAGCCACATTTCGTTCATTTCTGTCAGTTGTCTTGGCCAGCCGGGTGCGAATGAAAGCTGCTGGTAGCAACAAGCACGAGCTTGTG
CTTCGCGACAAATCCAGCAACATCAAAATTCGAGCGTTTTTCAGTTAGGTCGTCATCCGGCGCATCGGGAGCACTTCCTTCCTGGCGGAAAAGCAGCGAG
ACGTAGCGGTGTTCCCCCGGGTGGTGTCACCGGGTAGTACGGCACTACTACTACGTTTTGCGGCTGGTCTTGAACACTCTGCCCGTCCACAGCTAGGCCC
GCCAAGATGTAGTGCAGGAACGGCGCGTGCGTCGGAGACTTGGGATCCGGAGCATCAATGTCGATCAGCACGTACGTGTAGCGCCCAGCACTGCCAGCTG
GGCTGCCTTCAATAGAGACACTCGGTGCTTCTTGAGCCTAGCAGTCAAGACGAGCATGATGTGAGACTTGCACTTCGTCCAACGGATTAAAAGGTAAAAG
ATCTGGTGGTGCCAACCTCCTTCATGGGCACAAATTGCCCCAGGGTCACGGGGTGGCCGCCATTGAACGCGATAGCGATATGGGCACTGCTC