Description :
From Genome Similarity Track
Location :
Scaffold_57:129836- 132601
Transcript NameFunction/comments
Phyca_LT153463428unknown
Phyca_LT153447911secreted protein

Sequence
2765 bases(100 bases per row)
cgtagacgggtgtatacagtgaagcaccaactcgaccacctccccataagtttgataaccaactcgctcttgcctgctgccagcaatgcacaagcacctc
caatgcgcaatgagtgcgtcgagtattcggttgggtttccgcctcgtcttgctgctatctctttgatgagctttgccacttccgtctttcggattgttgt
agtcgtactgttcgacgtaaggtaaggtccgaggcgtttgcctgcgcatatccaccggctccttgccgctaaacatgcttccgccgccgccactgggcat
aaggctgtctgtccggacttgtaatgtctgattctgctgccttgccgggtacgatcgcccttgtgagagcggaataatatctcaactgaatttgcattcc
cgtggcctggttgcacgactgctccccttctgtcccgaaggcaaacgtcggtcgccctcacgcagtggctagtaccgcccgtggaggtgtccctggccac
cggaccccaccgctccgagctacggtcgaggaagaaaaacgcaagaattatcgatccccatagcatgtctatgtgttccgtgtttccgttgtgtcgtcgt
tgctggagttccgcaaacatctcgcacagcatgggcgtggtaatgggctgctttcggtccacgccgctgttggttcgcttatacccctgagcaatgagct
caaattccgcattcttgtaattgagccgggcgttccgcacgctcttgtgggcaaaggcaactgctgccatcttgccatcaaatgtctggtatttgtttcc
acgtttgtgagagttgtggccttcaagggagcacactcctgcaaatagtccgacaatcctggcttgtcgttcctgtggaagttggtcgatccagatcggg
aagccgaattcctcgcagaagttggtccagtgccgaaacttcttggagtatgtccccaatgtcgattcattgattgccgctctccggaggcggtttgttg
cgtttgcaatgatgctgagtcgatctgtccacatacaaaaccacactggtgagttgatacgtgtacatcacaggatcgcgcttcagcggttcccactgga
actcgggtaaccgagagtttgactctcttctttgcttgtagtaatgccagagatcttaactgctgttgtccttctgaagaactgcagaatagcttcgtca
aaagtcgcacttcccatgatgtgaatacatagagtcaaatgtgcttccacatggacctctgcggttccaccggtacccattccttgatcatggtgagaat
tgtgcccacgacttctgtttcaccaactgggtcgctaaagtccaatcgtctggaacgttgtggtgataatccatgaaccgtagtggtgtaaccatgatgt
aggactacccaaccgtctgatatcgctggctccgcgccaaacatgctcatgggcacgcccgcaaactcgttctcaaagaccagcttgtcccaccactcta
ggtcacccttcaacatgtttgtcataggaacacccgatctctgtgctcgtttggacgccaactggacgctgaccaaacgttggataaacggtttggcaat
gggaatgaacgtgaccacgtgtcgaagaactccaactagactgtccagttgtttctgagtaataaaacgcttgttaagtgtctctgcgatcactttcttc
actttctcgatcttgtaaagcggtatggtgactgttgtatcaggaatattccagtcgatgccaaccgcatggaaacactgagaccatgttctgaatttcc
cttcatgccaaccatcattcccaaagacaagtttcactgcgtctcgaagtcttcgctctgcgcgaagcaatcggtcttcgatatctacttcgatgatgac
gatgtcgtccacccattggaagatccagaatgccgacgggaaccctcggatgtatgatctgcctgtacgttggtagtgtctaaccgctttacccaatact
gcaaagtatcctggggatgccgtccaaccgaagactgctgatcccgatacaatgcccacctgtgagtgtggaatagtacccccaaaagctgatgcgtgtt
tggaatggacaggtacatgatgaaaagcgtcagcgatgtctgcaccgagcgcatatatcgaacggagttctaaaacgcgctgagcgatcgaatggaaggg
atcccaccgggcatcagggttccgcgccgtgtccgtgaaatcattgatcgatgctccccgtggagctgatagatcatggatggaccgaccatccaaatgg
agtggtacgtccttcttggggacgagagcgaatgcactcgagtggaacgccggttccgccgctagagctgccacacgcgatagaatacaacgcccgtggt
agtattcctgtaataggcggtgtgtaagcacggctgagccttcaacagcactggggtagttagatggtactggccgtgtgccggtgcgtggaccctggtt
ccgccagtgcggaattaccccgttctctgcgatgctgcaaaggagatgtaggtctgcataagaggccaaatgtacctggtacagctgaggccgcagagcc
ttgttaggacgctggtccttcgaggtctgtcctctgaaaactcgaagtgtgcctccgattcccaactgagggagacgaatgagagctgttagtgtggcgt
agtggctcgcgaggaaactcgacgcgaggggcactcacacacttggcgtccggactcccgactga