Description :
From Genome Similarity Track
Location :
Scaffold_53:12982- 21257
Transcript NameFunction/comments
Physo_137309hypothetical protein
Physo_159301PsAvh345

Sequence
8275 bases(100 bases per row)
CGACAAGGCAGCCCGCACACCTGCTCTCTCCTACAGGGGCCTGGCTGAGTGGGCTGTGACTCCCGGCCGCCCCAGGCAAGACAACGATATACCGCATAAT
CAAGTCAAGTGCAGTCCTGCTGGGGCGGCCGCTGGAGAAGGACCAAGGAATCATTCATTGTATTAAGCGACACATTCTATCCCGCAAGATGATGCAGCCT
CTAGACCGGCTTGGTGAAGGGCTAGGTAATCCCTACGAGGTCGACCAGTTGACAGCGCTGTTATGGTGCGAGGATGCCTGGTCAAAGGTTAGTGCTTCGA
CCATACGCCACTGTTGGAATCATTCCGGACTCGTAGGTAAAGCTGCTCTTCAGTTCATTTTGAAATAACTAAATCAGTATATTGGAAAAGTATACTCAAC
TTAACATCAATTTATATAATCTGCGTCTTTATATATATCAGGCGCTCCTTACTCGGGCAGATTACTGTATCCTTTTACCGCGAAAGGGTTAAGTAATGTT
TTGCTTATGCATGCCATCACAGATTGCGGTACATGTATTATTCGGGACTGGCTAACGAGGGCCATTTCCAGGGAAGGCCATTTTCATAAACAATGCATTT
GATCATGATCTGTTGAGGAATGGGCGAGGGCGAGCGGATGCGAGCGCGAGTCTGTCTCACTCAGTGCATTCACTCGTTCCAACGACCGCCGATTAGGCGG
GGCTGGTCTGCGCGAGCGAGCACAGCGAGCGCTGCAACCCGATATTTTTTTTCTAGACACCGCGCCTGGCCGAGTCGAGGACTTCGACTAAGGGGGTGGG
GCAGACCGCGTAGCGGTGCCCCCCGTGTCGAAGTCCGCAGACGAGAGCCAACGCGCGAGTATCCGCCCCCCCCCCCCCCCTTCAACATGAAAATATGCCC
ATTTTTTGAAAATGGCCCTCCCTCGTTAGACTCTCCGTTGTGAGCACCGGTGCCATATCCGAGACGGACATGACTGTGGTCAGGACATATAAGTGGTCAG
TGCCTGGTATACAAGTGAAGGTCAATAAGGAAGATGGGTACCCGGCCGTAGATCCCATAATATTGCTCGCTACAAAGCCTAGCGCACATGGTTCAAAAGA
GGAGCTTCTCCCCAGCAATTTGAGCCTATTCACAATCGCGAGCGACTCATTCTGCACAAGCGCCGACCGTTCGAAGGCAAGCCGATACAAAGCCTATTTG
AGCGCTGGAAGCCTCTTATGCACAAAAGCGGGGCATTGTACCAAATTCCATAGTTTAACCAAGTGTGTTTCAGGTGACCACCAATCTGTCCGTGTGAATA
CTTGAAGAAAGTAATGGGACAACATGTGACCATTTATATGTCCGGCGCAGATCGGTTATCAAAGCTGGCTACATGTAGCAGACCGTCCCAGGTGTACAGA
CAACGACGGAAAAATCCGGCAACGCAATACCCGGCATTCCATAGGCATGTCCATACAAAACAAGCGATGATTTTGTCCAATCAAATTTATTTTATTCATA
AAAATAAGCCAATCACCGCGATTTAATTTTTGAATGGATCTGGTAAATCCCCGTGTGCCATTGCCTAATTTGGAGCTGGTCGACTGAGCCGCTCAAACTG
TTTTTCGAGCCATGGAGGGCACGCCGCCGCCCAAGAAGAAGCAGAAGAGCTACACCGTCCGCGAGAAGCGCGAAGCGGTCCGCCTCGTCGAAGATGAAGG
GGTGGAGGAGGCAGCCCGCGAGCTCCAACTTGCTCGGGGCACTGTCCATGGCTGGTGGAAGCAAGTTGAAAAGCTTTTTAGCTTCACTGGCCACTCCACC
TCTAAGTCCCTGAAGGGCCAGGGCCGCAGGGAAGTATTTCCCGACATTCCTGCGGTCGTCACCTTCATGAAGGACGTGCGGCGCGAAGAGAAGGTAAGTT
TGTTTTTTTAGAATCTCATAATTTGTAGCGTTTAACCGTTAAACTTTATGCTATAATGTACAGGCCCTCACTACACGTGGCATTATGTCCTTCATGTGGG
CAATCGAGACCGAGTGGGTCGAGGACTACCTGCAAAGGAAGCGGAGCGGCATCCTGGCGCTTGAGCGCATGGTCGAGAGACTCGCAATTCGGTAAATAAT
TTTGTTTTTGCTAAAACTCCATCAGTTTCCTAACATTTACCTTTATTTGCGTGTTTAGGCATGGTTTTACCTCCCAGAAGCCACAAACGGCAAAGAAAAG
CACCGAGGAGCTAGATCAAACGCGCGCCGAGTTCGCGCTGGACTTCTGGAAGACGCACGCCGTGTACGGGCCGGAGGGCATGTACAACGTGGACGAGACT
GCCATCAATTTTGACATGCCTCCGGCTCGGATGTGGGCGGGTAGAGGTCGGCGGGACGCTGCGAGGATTGCGAACACGTCCAAGCACACCGGCCGCATGA
CGGCTGTGCTCACGATTCGAGCTGATGGTAAGTTTTCCTTTTTGTTGTTCTCTTCATTTTTTATTTTTTAAGGCTAATTTGTATTTGTTATACTATTTTT
AGGGGAAAAGCTGCCGATTCTGTTTGTTCTGCGTGGTAAGCTGGGCGGTCGAATCGACACAAGCGAGTTCGAAGAGTATCCGGAAGGACACTTCTACACC
GTCCAAGATAACGCTTGGATGGACGCTGTTACGTGGCGTTTTTACGTAGAAAAGTTGTTAAAATATGAAGTTGATGGACCCGCTGTCCTCCTTCTTGACA
ACTTTGAGTGTCATGGGTCGGAAGAGGGGCAGCGGGTCGTTGCCGAAGTTGCTAATGCTACTGTGGTCCCTCTACCCGCAAACAGCACGGCTGCTTGCCA
GCCGCTGGATGTCGGTGTAATGGGGCCACTAAATGCAAAGTTGCGCTCGAACTGGTCTGGCATCACGGGTGGCAGTGCTAAGGAAAAGCGGCTCCGTGCC
GTTCGCGCTACGATTGCTGCTTGGGATGCCATCCCCGAAAGCACTGTAATTAGGAGCTTTAAGGCAGCTATTCCTCAGTATCCTGAGATTAGCATTTGAA
TAAAATGCAGCTTTTTTGCAGAACATTCTGATTTGTGCTTTGTTTTGAACAGTTACGCAACCTTTTAGCCAATCATGTTTTTCTTTTTTATCTGTGCCGT
ATTTTGTGTTACACTCCTTAGATATGGAGGATGGCAGTCAGTCACGCCGGATTTTTCCGTCGTTGTCTGTAGGCGTGTCAGTTCGCTATCCGTTCACTCC
GTCACAACCGTTGCTCTCCGGTTTCCAGCATGCGTACCCAGTTGGTTCCAGCTGCACGGCTCCATCGTATCACCCTGGTAGCAGTCGTGACACTATTGGC
TAGTGCCTTGGTGGTGGCTACGGACTGCAGGAGGATCATCATCGTCAACTCTGGGACGTCGGAGAGTGTTCTTGGGGTCACCGGATCCAAGCGGCAGTTG
AGGGCCCGTAAGCACCAGGGCGACGAGTTTCCCGAAAACCGAGGCCTTAATTTCAATAAAGTCCCGGGCGTTGCGAATGTCCTCCAGAAACTCTCAAAGA
ACCCGGCCAAAGAACTCGAAGCCGAACAACTCTTCCTCAAGCTGAATCTCGCCAACGCAAAGTCCACGTTGTTCGAGAACCCGCAGTTTCAAGCGTGGAG
TGCCCGAGTTGTAAAAGGGCATCAAACGAAGCCAGAGGCTGCTCAAACGGCGATTGCAGCGACTTTGACCAAGCAACTCGGCGATGAAGCTCTGGCGAAG
ATGATCGCGGCAGCGAAGGAAGTGGAGGGTACTAAGAGTATGGCTGCCCAATTGGAGCAGGCGCAGTTGAAGAGCAATGAACGCAACGCTAATTACGTGT
TCCAGGTGCTTAAGCTTCATAAGGAGACGTGCAGTCTTCTGTGGAACCCGCTGCTGAATACCTGGGCGTCCTACGCGAAGATGCTGAAGGCGGACCCACC
AATGCTGCTGTTCGACAAGATGAAGGCGCACTATAGTGACGCAACGATCGCGAACTTACTGGCCTCAGCGAAGCGGGAGAATGCCGCGCCGTTTATTGTG
GACGACGTGGAAAATTTACTGTTTGATACGTGGATGGCCAAAGACAGACTAGGGACGAGATTTTCACGCTTCTGGGACTGAACCATCACCGCGATCACCT
CTTTAACGTCCCCGAGGTCAGCACTTGGGTCTCATACGTGACGAAACTCGATCGGGAGGGAGCAGACGAGCAAATTTACAAGACACTCACGAAATATTAC
AGCGACCATGACGTCACGGTGATGCTTGCTGGGTCTAAGAAATATCTCAGTGCCGATGTTGCTAACAACTGGAGGAAATGCTGCACAGCTCTTGGCTGGA
AGAGGCGACGACTGCGAACACGATGTTCGCCAAGTTGAAACTGGACAACCAGGGGGAGAACCTGTTCGAGAGCCCCGCGTTTAGTACGTGGGTGCCCTAT
GTGACCAAGTTGGACGCGCAGAACGCCGGTGACTTGATGCTAGCCGCCTTAAAGACGAGCTACACGGATGACGCTCTGGCGAATCTACTGGTAGCAACGA
CAACACGAAGGTCCTTGCCGACAAACTCGCGGGAGCTCAACGCAAAGATTGGCTTAACGATGAGAAGTCCGCAGATGACGTTTTCAAGCTACTAAAGCTG
GATGACGACACAGTGGGTGATCTTATGAAGAGCCCGTTGTTGGGCCACTGGGAGGCGTATGTGAGTCAACAGCTGAGAGAAAGCCCGTACGAGATACTGC
TAGTGAAGCTGAAGGCCGAATTCCCCGACTCTGAGGGCAAGTTCGCCGATATGCTCATGAATGCTAAGCAAGACGCCAGTACAAGTGTAATCGCGGGTAA
AATCGAAGCAGCACAACTCCAGAAATGGTCTGGCGACGGGAAAACCGCGGGTGACGTCTTCAAACTTTTAGGTTTGGACCGGGAAGGGACTACCCTTTTG
TGGTATCGTAGAGTGCGGATGTGGGCGGCGTACGTGAGTAAGGTGGAGGCAAGGAATTCAGACGAAACCATGGCGTCGGTGCTGAAGGCGCACTACGACG
ACTACGACCTTGGAATGATGATAGCCCACGGACGGAGCCACGATGAAGAGATGACCGTGAAGTTTGAGGAGCTGGTGCAAAAGATGTGGCTGAGCGAAGG
GAAATCCGCGGACGACGTGTTTAACTACGTGCTAAAGAGGCACCGACAGTTCATTTTCGAAATTCCAAGGGATTTGAACACTTGGGTCTGATACGTGACC
AAACTCGACGAGGAGGGCGCGTACAAGGCAATGTTTGCTGTTCTAAATCGACGCTACGACGAGAAAACACTCGCCAAGATGCTTGATAAGGCTGAAGACG
CCAGTGACACGAAGCGACTTGCCGAGAAACTGGAGCAGGAGCTGTGGCTGAGCAAGGGGCAAACTGCCAAAAACGTTTTCCATGACCTAAACCTGCACCG
GAAGGGGGAATATCTGTTCGAGAGCTCGGTGCTTTACAAGTGGGTCTCCTACGTAGCCAGAGTGGACAAGAAGAATGCGGATCAGACGATGCTCTCGGTG
CTGGAGAGCAACTACGGCAAGAAAGACCTAGTGAAGTTGCTTGTGACCGCAAAGAGTGACAGTCAATGGAAGGATCTTGCTGCTAGACTTGAGCAACTGC
TGGCTGGTCAATGAAGGTAAGCCGCTTAAGCCAAGAAGTTGGTAGCAATTCGTTCTTCATGGAGCACCTGGAAGATTCGAACAGAAAATCATGCTGTCAA
AGCTATTGTACTTCAGTACCTGAAAACTTTTACCGTCCACTACTTAGTCAGGAAGCAGGACAGTTGACCGATCGGTAGCCGCGTCCCATAGCATCACATT
TCGTCATTGCTTTTCATTTGTCACTTGAGCACTACGACAACGACAACGATGAGCTCCTCCATATCGCTCGACTTCGACGACAAGCAGGAGTTCGCCGAGT
TCGTGGCCGCTAAAGCTCGCGCTAACTGCGTTCACTTGGTCTTGTGCCATGGAGACGGCAAGGAGTACCGCGAGTATCTGCTCAAGTGTGTGGGTCGATG
GCCTTCAGGTCAGTTGGGCAAGATCGACAAAAGTCACGCGGTGGACGTGAGCGACGCCCTCCAGCACACGCAAGACGACGTGAACGAGCGCATCGGCAGT
CTTCGCTTACAGCTCGCGTCGATCGCCGACGCGCTGTTCTCCGTCAATGCCCAGTCCAAACCAGGCAGGCGCTTTGCAGCCGTGCAGACGCTGCGAGCGT
ACGTCGAGGAGCTGCAGCAGGACGAGCAACTCTGGAACAAACTCGAGTCGCCGACCAGGTTCGCGTTGTCGTTCCCGCTCCGCAAGAAGCGGGAGATGCA
GCAGCTTCTTCATTTACTCGGCCAAGACGTCCGAACGGTTTGGGGTGATGCAGTGGAGCGCGTGTTCCAGGTGATGCAAGTCGTCCACCAAGACGCAAAG
CTTCGAGACTATGGTCTGGTTGCAGCCAATGACTCGCGTGACAAGGCCCGCGATCGAGCGCTGTCGAAGGCCTTTCGCTCGCTGCTTGAGCACTGGAGCT
GCCGCCGGTCGCCTCGCCAACTCACGCTCACTCCGAGCCAGGATGGAGGTCGGATCCGCTGCCGAGTTGAAGAGACCGCGTCGATGCAGTGGCAGAACTC
GCAGCGCTGGCCACGCGAGCGACCCGCGCTCGGTGGTGGCTACGCAGCTTCGACGCGAGAGGACTGGTTCTCGTCGCCTCCGAGCTCGCCCGAGAATTAA
CGCCCCCGTCCTGGCCCAACGCTGCTCGACTTCATGGACGGCCACTCGTCGCTGTCGGATAGCGACGAGCTGTGGTGAAGCGCGGCTACTTTCCTGCTCG
GTAGCTTTATATTATCTTGCATGTTCGAGATTATCTCCATGTTGTTGGATCCTTGGTAGTATCTGCGGCGTGCTCAACGTTTGCGTGCGAAGGAAGCTAA
GGGGAAATGGCACGAGTTCTCTCCATATTCATCCACACCTGTAGATCTGCTGCCCTCTGTTGTCGCGCTTTTTTAGGCGGGGCTGGCTGGTCAAGCAGAC
CATGAAGAGACACCTGGGCTCGATCCAAGAACGCAATGGCCAAGCGCCACGCACTCGACCTGCAGGTGCTGCATGACCGCCCCAGCAAGAGGAAGTCCAA
GCCGACCCCCACTCCACACGCACCACGACAAGCGGTGACTACCAGGCATTCTCGACGCGAAGTCTCCGATCGAAACCATGGAGGGGACCAAGTTCTGTAC
GACGATGAAAAGGACGACGACGACGACGATAGTAGAGAGCAGATTCAATCGAGTCCTCCCGCGATAAAGAGAAGCTCAGTGAGCGACACTCGACTGCATG
GCGAGCAGCTGCAGCAGTTCGAGTCGTGGCTCAAAGCTCCGGTCGAGAAGCCTGCGGTCCCGGGCGCTGGGGCCGCCAAGCGCGTCCCCGACGGAGACCT
GCTCATGTTTCGCGACAAGCGCGTGCTCGCCCACCCTCCGATTTTCCCTGCCGAGGAGAGGGCAGCAACAAGAGCGCATCGAAGCTCAACGCGTCGGCCT
CGATCCTCAGACGAGAGTCCGCCACGAAAGACTGCGCGGTATGTGGACTCGATGATTAAAGAGGCGCTGACGGTGTCGCTGCCTCCGATCATGAGCCCGA
CAAGCAAGGACAAAGCTGTCGTGGAGCAACTGCTGGCCGATTGCAAGAGGTACGTGCGAGCTACGAGGAACGAGTCGGCAAGTGGCTAACTGTTTGGTGG
TTTGAACGGTAGGAAGGCTGATGCCACGCCTGAGCAGCAAGACAACCAGAACTCTGGTAGATCAACGACCCCCAGTGTCGGCATCGTGCTGCCAGACCAG
CTCTTCTACGAGCAGCACTCATTCCAGCCGCTCGCGAAGGTTGATCTGAGTGACTGGGCCTCCTTCTGTACTGAGGACAGCGCAGTACACGGTCAGATGG
CCGCGAAACTCTCTCAACGATGCTCGGATCTGGATCTGAGCGGGCTTCTGACTCTCACACGAGCCAAAGGTACGATACCGAAGCGCGCCGATGGTCTTTG
AATTGATGCAGACTGATGCCACTTTGCAGACTTTACAGCGCTACTTGAGAACTGCCCAAAGCTGCAGCGTCTTGTGCTGACCAAGTCGGAAAACATACCG
GTGAGTTCGATTGATCGTTCTTGTAGCCGACTACCGAATTCCTCGCACTAATTGATGCCGTCGCTGTCTTTGGTCGAGGCTGACCTTCTTGTAGAAAGCA
GCGTTCCATGCCGTAGCGCGCAGGTGTCCGTCAATAAGCGACCTGGCTCTAGCGGAGAGTGACTCCGTGACAGAC