Description :
From Genome Similarity Track
Location :
Scaffold_281:1298- 3900
Transcript NameFunction/comments
Albla_Nc14113400
Albla_Nc14113410

Sequence
2602 bases(100 bases per row)
TAGCATCTCTATCGATGTGTGCACACCCCCTCCAGCCCAATCCTGACGAGTGGAATGGCGTGCTGTCGTATCTTTTTTTTTGAAGCCAAAATTTCAGACC
GAAGAAGCTCCTACAGCTTTGTACGAATGAAATCTGGAGAAAAAGGGTGTGACTAGCGTGGCCGGGCAAATTTTCACGGTCACAAATTTAATCACAGGTA
ACGACAGAAAGATTCCGCCCACTTAAATTTGATCGATCCCATACCATGAAAACTCCGACATAGGGTTAGGTTCCGACGCGGGTTCCGACACATTGCAGCG
TCTTCTACTATTTAGAAAGGATCTAGTGTTAAGGAAGCTATAAAGCAGGACGCTAATAAGCTACTCACTGTACTACTCCCATTGACATAGCTAACTTGGT
GCTGGTTGGCGTCAAAGACTGGGTACTCATGTTCTTGTTGTTGATGTGTACGAGGGTTTATTGGAGTCGCTCACAATATGCAGTATTTTCAACTCTGACT
TGTCATTGGTATACTGCTCAGACATACTTCCCAATTAAATTATAGATTTTATTATAGTGGTGCTGATTTGGCATTTCTATATTGCTCCAATATACATATT
TCTAACTTATATTAAAGAACTCATTACAGTGGTGGTGTATCTTTGGCATCTGCATGCTGCTCAATCATATTTTAAATTATATTTTGTAATTTATTACAGT
GGTACAAATTTTGTCGGAGTTTTTTACAATACGCAACATTATGTACCTCTGATTTGGCATTTGTATGCCGCTGAAACATATTTCTAAATTTGTTCTCGAC
AAAACATGTCGGAATAATGTTGGAATGAAAAAGACCTAACCCGCCCTAACTCTATTATTCAATTGGTTGAAACAGCAAAAGTATTTATCAGACATCGGCT
ATAATTATATGGCAATCTCTTATTGGTCTACCGTCGCATACTGAGGACAAGTGTTTTTTTGTTTGTCGAAGTTATCATCATATTCATCCATAGAAACAAT
TCAGAACCTGATGGACGGAAAAACACTGCCACCTCAAAATACATAAATTTCACTGGCTGATTTTTGACCAATACATTTCGAAAGCTTCCAAAAACGATAC
AAGCTCTAGTATCGGTTTGAAATGCCAAATGAGTGAGTGATGGTCAGCTTGCAAAGCGTCCAGCAAAGCTAATAATTTGACAAGTCCCTGTGGGTGCACA
ATCTAGAAAATATATTTCGTGAGAAGTGCTACTGACTAGACTGTCATTTTTGTCGTATGAGAGATGGCTTTTCTAAAGCAGCTTATAATCACTTCATCGT
CTAGCTTTCCACGCTTTGATCGTTCTTTTGATCATAATGAGTCGCTTTTCAGCGGTACTTTTTGCTTCCTCTTTCTCTGTCAGCCACTTATCTCGGAGTT
TGGTTTTCAGTGGACCCATTACACCGACGTCAAGCGGCTGACAGACAGCAGTGCTATTTGGGGAGAGCGGGACAAGGGAGCAGCAAGCTTCTTCGGCTAC
CTGTTCTTTCGATGCTTAAGTGACATGGCAATCAAGATTGTCTACAAGATGGACTGATGAAAAGTTGATTTCATAGCGCAGTAACTCGCTAATGTAATAT
TGCCATCCATTATCATCCATCCAAGCTTTTTGCTGAACTCTATAAACGTGCCCCTTGGGGTACGAAAGAAGTTCGTTTCTTACTCAACCAGGTGTTCCTT
TCAAGATAAACATGATTGGAACCTTTTGCCGATCCACTTTGATCCCCAAAACAGCAGTCAGTCTGGCCAAATGACGCCGGGAAACATCAACCTTTGGTTG
CTCGCCCACAATGTTTCAAATTTTTTTAGGCAGCATATCATAATAGATGCCTATCTCATCTACATTAACAATACCGCCAGGCTCTACCACGGAATTTTCA
TTCCATAAAGCCTCACTGAACTTTCGTTTGACACCCTTAATAGAGCGCTGCTTCGTTTCAGATGCAGTCTCTTGGGAAAATCCATGCCGCACTGCGAGGC
GCTGGCATAGTTTCATGAGAGCGGCGTAACCGCGCTTCGCTTTTCTTGTCCTTCGAATAGATCTGAAGCCACTTAAAGTGATTGACCATTATGAAACCGA
TCATGTGTCTCGTCGCAAGGATCTAAAGGTGGAAAGATTAGAAAAATGAGAAACTTACCTAAAAATATCAAGTGTATTTTCGCATTCTTATTTACCTTGT
CGTGTCTGAGGCGATCCTACATAAAGATCACAAGCTCCTGCGTGAACGGCATCAGTTCATGTCTGCCCTGTCCTCCAAATGTCGTCTTCTTCACATTGCC
GTTAAATTCGTCGTACTCGCTCGCTTTCGCAAGCCAATCGCGCAGCGTTCTGCGTGGAACGGAGCACTGTTTTGCTCCTTCCCGCTCGCCCACTTCGCGC
GCAGCTTTGATGGCGCCGATCTTCTCGCGGATCTTGTACGAGCGCTGGCGCTGTTTGGGTACGCTTGGGGCTGCGACGACAGTCATCTTGTGTATGCAAT
AGGCTGGAAATGAATGGAGAGCTGAGAAGAGAGCTACTGTGTCTCTCAAATCGCTTGTAAAACAGACCAACCATTGCTTTTGCCCATATCCTTTTTTTTG
AT