Description :
From Genome Similarity Track
Location :
Scaffold_141:12979- 14098
Transcript NameFunction/comments
g10259.t1hypothetical protein

Sequence
1119 bases(100 bases per row)
GCAAGTGATTTGTGCCTGTATTAAATATGTTTGGTATGTATCTAGCTATTAACGAGGAAAAGAAGGGTAAGACACTCGCCCGGAAAACCTCTATGCAGTA
CTACAAACAGAGTAAGATGTGGTTGTTCGAGCTCTTTCCTTCGTAACGACACATTGTCGAAGCAAAGTTGTTTAGCATGGGGAAGACGCTTGACAGCTTC
TGCATGAAGCGATATGGAAAGGTGGTCAACAAAGTTCCACCGTGCTCAAAGAGTGCTTTAAACAAATGATACTGTATTTGAATCAGAATGTATGCTCCTC
TAGTGACTACCATGATTCGGCTTTGCTGTGTATGCTGTGGTACCTGTTTGGACGAGCTTCAGATCTGTCGCTCATCCGCAAACACAACCTCGCTGTTGAC
GCGGCAGGGGTGTTCTTCGTGCAGTTCATCCGTATGAAGACGTCCGAAGAACAAGGTCTCTCGCTGTTCCCGGATCCCGATTTCATCACCTGCCCGCTCC
ATGCTGTTGCTATGGCGCTTGTCACGCAGGCAGCACCGTCCGTCGCCTTGATCGACAACTTGCCAGTGGTCCCATTCCTAGCCGCTGTCAACTTGTTTCC
GGCGACGTCGCTGATGGAGGTCTTGAATCATCCTGACGAGTTCACCGGTCTAGATGCTGCAGCCACGCCTGTCGTTGCTGCCCCTGTACCACCCCGACAA
TCTACTCTCACGTCAATCTGCTGCTTGATCGTTTCGCACGGACGGCTGGTGTTACCGTCGCACTCACGTCGCATTCGTTTCGCCGCGGTGGTGCTCAGCA
TGTCAAAGGTTGCGACGGACTCACACACCGCTGAATCATTGACCGTGGTGGTCCACAACAAACAAGGGGCTCAACTACATCTTCAATATAAGCAGGGAGG
ATCACCTGGTTAGTAAGGCGCTCAGCGGCTACGACACGAAGACCACGGTGAAACTTGCTTCCATTCGATGCTGAGACGCAGGAGAACATCGCAGCCGTCC
AACGCGCGCTGTTCTCGACCTGCGACAAGATGAAAAGCTTCAAGTACAATCTCAGCCAGCAAGTTGCAGATGTCCTCACCACTTATCTCATTATGCACTG
CCCCTTGATGAAGAAGCTG