Description :
From Genome Similarity Track
Location :
contig_4:129769- 131479
Transcript NameFunction/comments
g1206.t1hypothetical protein

Sequence
1710 bases(100 bases per row)
TGCTGGTGCATGAATTTCGAGAGTGGAGACGGAGGGTTGATACTGTCATCAAACGCTCCTCCGGCAGGCCCACTGCTCCAAGTTGATGAGGAGGTGGTCG
GGCGGTCGCCGTAGTTGCTGCCGTTGCTGCTGTTCTTGCGCGCTAACCAGAGTCGTCGCTTCTTTTCCCAGTTCTGGTCTCGCTTGGAGGACGTGAGCGG
CGGTTGGGAGCCCCAGGAGCTTGAGCTCGAGCTCGAGCGGATGCTCGACCGAGAGCTCGGTGTGGGTGACGAAGAGCGGCCGACTTGGCACCCGTTGGTG
GTGTACCCAGAGCTGTTGCCGTAATTGTAGCCGTTTTGGTTGCTGGCAGTGTGTGCGGTCTGGTACTGGTATGGTTGCTGTTGCTGGTACATTTGCTGCG
AAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCTGCATAGAGGAGTAGCTCGGATAGCCATTGCCCGGTGCGTTGCCATTGTTATTGCTGAAGCT
GGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGTGCCGAGTCCACCA
CAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCAGGTGGTGCGTGAA
GGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTCTTCTTCTTACTGG
ACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGCGCTGGGGAAGCAA
GCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCCTGCTCGCCATAGC
TATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGTGCATCCTCAGTCC
GCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGATCGACAAGTATGA
TTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTTCAGTGACAGCTGC
GAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAAGAGCAGTGTCGGC
AAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCTGAAGAAGGTGAAT
CTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGGCTACTGACATTGA
TGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTCAGCAACTCGAGGA
TCATCTTAGC